EMAIL THIS PAGE TO A FRIEND

LOC84931

32 Gene Product Result for
Species: Human LOC84931(84931)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032845 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032845 Rosetta Predictions human pricing
XR_017947 Rosetta Predictions human pricing
XR_040110 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175286 predicted 407
2 SASI_Hs01_00175287 predicted 430
3 SASI_Hs01_00175288 predicted 162
4 SASI_Hs01_00175289 predicted 89
5 SASI_Hs01_00175290 predicted 442
6 SASI_Hs01_00175291 predicted 225
7 SASI_Hs01_00175292 predicted 322
8 SASI_Hs01_00175293 predicted 450
9 SASI_Hs01_00175294 predicted 1030
10 SASI_Hs01_00175295 predicted 73
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495007 predicted 213
2 SASI_Hs02_00495008 predicted 220
3 SASI_Hs02_00495009 predicted 205
4 SASI_Hs02_00495010 predicted 230
5 SASI_Hs02_00495011 predicted 223
6 SASI_Hs02_00495012 predicted 218
7 SASI_Hs02_00495013 predicted 220
8 SASI_Hs02_00495014 predicted 200
9 SASI_Hs02_00495015 predicted 196
10 SASI_Hs02_00495016 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515959 predicted 210
2 SASI_Hs02_00515960 predicted 218
3 SASI_Hs02_00515961 predicted 203
4 SASI_Hs02_00515962 predicted 227
5 SASI_Hs02_00515963 predicted 214
6 SASI_Hs02_00515964 predicted 212
7 SASI_Hs02_00515965 predicted 220
8 SASI_Hs02_00515966 predicted 200
9 SASI_Hs02_00515967 predicted 202
10 SASI_Hs02_00515968 predicted 634
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032845
LOC84931 MISSION shRNA Bacterial Glycerol Stock
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000172734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032845.1-332s1c1
Sequence:CCGGGCAGAGTACGATTTCTGCACTCTCGAGAGTGCAGAAATCGTACTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032845.1-496s1c1
Sequence:CCGGCCACATCTACCCACAAGGTATCTCGAGATACCTTGTGGGTAGATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032845
LOC84931 MISSION shRNA shRNA Plasmid DNA
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000172734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032845.1-332s1c1
Sequence:CCGGGCAGAGTACGATTTCTGCACTCTCGAGAGTGCAGAAATCGTACTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032845.1-496s1c1
Sequence:CCGGCCACATCTACCCACAAGGTATCTCGAGATACCTTGTGGGTAGATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032845
LOC84931 MISSION shRNA Lentiviral Transduction Particles
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000172734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032845.1-332s1c1
Sequence:CCGGGCAGAGTACGATTTCTGCACTCTCGAGAGTGCAGAAATCGTACTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032845.1-496s1c1
Sequence:CCGGCCACATCTACCCACAAGGTATCTCGAGATACCTTGTGGGTAGATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)