EMAIL THIS PAGE TO A FRIEND

LOC90462

13 Gene Product Result for
Species: Human LOC90462(90462)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36278 Anti-ZNF605 antibody produced in rabbit IgG fraction of antiserum human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183238 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_183238 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021894 predicted 1508
2 SASI_Hs01_00021895 predicted 817
3 SASI_Hs02_00371236 predicted 1181
4 SASI_Hs01_00021896 predicted 1494
5 SASI_Hs01_00021897 predicted 2267
6 SASI_Hs01_00021898 predicted 2275
7 SASI_Hs01_00021899 predicted 2281
8 SASI_Hs01_00021901 predicted 745
9 SASI_Hs01_00021902 predicted 1539
10 SASI_Hs02_00371237 predicted 1371
11 SASI_Hs01_00021900 predicted 869
12 SASI_Hs01_00021903 predicted 1253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183238
LOC90462 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183238.1-491s1c1
Sequence:CCGGGCTCCGAGATAATCAAGACAACTCGAGTTGTCTTGATTATCTCGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183238.1-2161s1c1
Sequence:CCGGCAGGAGATAAATACTATGGATCTCGAGATCCATAGTATTTATCTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183238.1-1714s1c1
Sequence:CCGGGCCTGATATCACATCAGAGAACTCGAGTTCTCTGATGTGATATCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183238.1-1366s1c1
Sequence:CCGGGCAGGAACTCACTTCTCATTACTCGAGTAATGAGAAGTGAGTTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183238.1-1153s1c1
Sequence:CCGGCAATAGAGAAACCCTACAGTTCTCGAGAACTGTAGGGTTTCTCTATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183238
LOC90462 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183238.1-491s1c1
Sequence:CCGGGCTCCGAGATAATCAAGACAACTCGAGTTGTCTTGATTATCTCGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183238.1-2161s1c1
Sequence:CCGGCAGGAGATAAATACTATGGATCTCGAGATCCATAGTATTTATCTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183238.1-1714s1c1
Sequence:CCGGGCCTGATATCACATCAGAGAACTCGAGTTCTCTGATGTGATATCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183238.1-1366s1c1
Sequence:CCGGGCAGGAACTCACTTCTCATTACTCGAGTAATGAGAAGTGAGTTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183238.1-1153s1c1
Sequence:CCGGCAATAGAGAAACCCTACAGTTCTCGAGAACTGTAGGGTTTCTCTATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183238
LOC90462 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183238.1-491s1c1
Sequence:CCGGGCTCCGAGATAATCAAGACAACTCGAGTTGTCTTGATTATCTCGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183238.1-2161s1c1
Sequence:CCGGCAGGAGATAAATACTATGGATCTCGAGATCCATAGTATTTATCTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183238.1-1714s1c1
Sequence:CCGGGCCTGATATCACATCAGAGAACTCGAGTTCTCTGATGTGATATCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183238.1-1366s1c1
Sequence:CCGGGCAGGAACTCACTTCTCATTACTCGAGTAATGAGAAGTGAGTTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183238.1-1153s1c1
Sequence:CCGGCAATAGAGAAACCCTACAGTTCTCGAGAACTGTAGGGTTTCTCTATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)