EMAIL THIS PAGE TO A FRIEND

LOC93432

24 Gene Product Result for
Species: Human LOC93432(93432)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376684 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008748 Rosetta Predictions human pricing
NR_003715 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070943 predicted 514
2 SASI_Hs01_00070944 predicted 585
3 SASI_Hs01_00070945 predicted 1222
4 SASI_Hs01_00070946 predicted 1003
5 SASI_Hs01_00070947 predicted 1200
6 SASI_Hs01_00070948 predicted 344
7 SASI_Hs01_00070949 predicted 1325
8 SASI_Hs01_00070950 predicted 1112
9 SASI_Hs01_00070951 predicted 572
10 SASI_Hs01_00070952 predicted 1130
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380435 predicted 498
2 SASI_Hs02_00380436 predicted 574
3 SASI_Hs02_00380437 predicted 987
4 SASI_Hs02_00380438 predicted 1187
5 SASI_Hs02_00380439 predicted 575
6 SASI_Hs02_00380440 predicted 1309
7 SASI_Hs02_00380441 predicted 1100
8 SASI_Hs02_00380442 predicted 1304
9 SASI_Hs02_00380443 predicted 562
10 SASI_Hs02_00380444 predicted 1117
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376684
LOC93432 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376684.1-930s1c1
Sequence:CCGGGCGATCACTTATCGCACGATTCTCGAGAATCGTGCGATAAGTGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376684.1-1119s1c1
Sequence:CCGGCGAAATCGTTTAGCTGAGATACTCGAGTATCTCAGCTAAACGATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376684.1-1311s1c1
Sequence:CCGGCCCTATAATAATGGAAGCCTACTCGAGTAGGCTTCCATTATTATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376684.1-1390s1c1
Sequence:CCGGCGACAGTCTTTCCCGATTATACTCGAGTATAATCGGGAAAGACTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376684.1-502s1c1
Sequence:CCGGGCTATGAAGTTTCCCATGAAACTCGAGTTTCATGGGAAACTTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376684
LOC93432 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376684.1-930s1c1
Sequence:CCGGGCGATCACTTATCGCACGATTCTCGAGAATCGTGCGATAAGTGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376684.1-1119s1c1
Sequence:CCGGCGAAATCGTTTAGCTGAGATACTCGAGTATCTCAGCTAAACGATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376684.1-1311s1c1
Sequence:CCGGCCCTATAATAATGGAAGCCTACTCGAGTAGGCTTCCATTATTATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376684.1-1390s1c1
Sequence:CCGGCGACAGTCTTTCCCGATTATACTCGAGTATAATCGGGAAAGACTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376684.1-502s1c1
Sequence:CCGGGCTATGAAGTTTCCCATGAAACTCGAGTTTCATGGGAAACTTCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376684
LOC93432 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376684.1-930s1c1
Sequence:CCGGGCGATCACTTATCGCACGATTCTCGAGAATCGTGCGATAAGTGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376684.1-1119s1c1
Sequence:CCGGCGAAATCGTTTAGCTGAGATACTCGAGTATCTCAGCTAAACGATTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376684.1-1311s1c1
Sequence:CCGGCCCTATAATAATGGAAGCCTACTCGAGTAGGCTTCCATTATTATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376684.1-1390s1c1
Sequence:CCGGCGACAGTCTTTCCCGATTATACTCGAGTATAATCGGGAAAGACTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376684.1-502s1c1
Sequence:CCGGGCTATGAAGTTTCCCATGAAACTCGAGTTTCATGGGAAACTTCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)