EMAIL THIS PAGE TO A FRIEND

LOC93622

108 Gene Product Result for
Species: Human LOC93622(93622)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138699 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138699 Rosetta Predictions human pricing
XR_017952 Rosetta Predictions human pricing
XR_041372 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194203 predicted 745
2 SASI_Hs01_00194204 predicted 853
3 SASI_Hs01_00194205 predicted 1065
4 SASI_Hs01_00194206 predicted 818
5 SASI_Hs01_00194207 predicted 1016
6 SASI_Hs01_00194208 predicted 932
7 SASI_Hs01_00194209 predicted 832
8 SASI_Hs01_00194210 predicted 906
9 SASI_Hs01_00194211 predicted 916
10 SASI_Hs01_00194212 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495047 predicted 1270
2 SASI_Hs02_00495048 predicted 1200
3 SASI_Hs02_00495049 predicted 1366
4 SASI_Hs02_00495050 predicted 794
5 SASI_Hs02_00495051 predicted 1171
6 SASI_Hs02_00495052 predicted 899
7 SASI_Hs02_00495053 predicted 858
8 SASI_Hs02_00495054 predicted 1054
9 SASI_Hs02_00495055 predicted 1283
10 SASI_Hs02_00495056 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526796 predicted 1273
2 SASI_Hs02_00526797 predicted 1195
3 SASI_Hs02_00526798 predicted 1370
4 SASI_Hs02_00526799 predicted 788
5 SASI_Hs02_00526800 predicted 1172
6 SASI_Hs02_00526801 predicted 899
7 SASI_Hs02_00526802 predicted 853
8 SASI_Hs02_00526803 predicted 1054
9 SASI_Hs02_00526804 predicted 1280
10 SASI_Hs02_00526805 predicted 974
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138699
VALIDATED
LOC93622 MISSION shRNA Bacterial Glycerol Stock
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-1464s1c1
Sequence:CCGGGAATGCGACTTTGGATGAGATCTCGAGATCTCATCCAAAGTCGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-1838s1c1
Sequence:CCGGCCAAACAGTCATTCCAGGCTTCTCGAGAAGCCTGGAATGACTGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138699.2-1053s1c1
Sequence:CCGGGCTCAAACCAAGAGAGCCTTTCTCGAGAAAGGCTCTCTTGGTTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_138699.2-682s1c1
Sequence:CCGGCGCGGAGTTGGTTTCATTCTTCTCGAGAAGAATGAAACCAACTCCGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143031    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-1839s1c1
Sequence:CCGGCAAACAGTCATTCCAGGCTTACTCGAGTAAGCCTGGAATGACTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138699.2-1119s1c1
Sequence:CCGGCCACTCAATTTCCAGTACCATCTCGAGATGGTACTGGAAATTGAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_138699.2-1157s1c1
Sequence:CCGGGCATTAGATGGTCAGGTGTATCTCGAGATACACCTGACCATCTAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138699.2-1010s1c1
Sequence:CCGGCGAACTGTGTTCACCTGATAACTCGAGTTATCAGGTGAACACAGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138699.2-683s1c1
Sequence:CCGGGCGGAGTTGGTTTCATTCTTTCTCGAGAAAGAATGAAACCAACTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_138699.2-1375s1c1
Sequence:CCGGGAGAGACTTGAGGTTAGAGTTCTCGAGAACTCTAACCTCAAGTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138699.2-1398s1c1
Sequence:CCGGGCAAGTGAGAAGACACTACATCTCGAGATGTAGTGTCTTCTCACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-1234s1c1
Sequence:CCGGCGTAAAGGAATATGGCCTATACTCGAGTATAGGCCATATTCCTTTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145507    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-971s1c1
Sequence:CCGGGATGAATTTCTCCCACTTGTACTCGAGTACAAGTGGGAGAAATTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-968s1c1
Sequence:CCGGGATGATGAATTTCTCCCACTTCTCGAGAAGTGGGAGAAATTCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138699
VALIDATED
LOC93622 MISSION shRNA shRNA Plasmid DNA
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-1464s1c1
Sequence:CCGGGAATGCGACTTTGGATGAGATCTCGAGATCTCATCCAAAGTCGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-1838s1c1
Sequence:CCGGCCAAACAGTCATTCCAGGCTTCTCGAGAAGCCTGGAATGACTGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138699.2-1053s1c1
Sequence:CCGGGCTCAAACCAAGAGAGCCTTTCTCGAGAAAGGCTCTCTTGGTTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_138699.2-682s1c1
Sequence:CCGGCGCGGAGTTGGTTTCATTCTTCTCGAGAAGAATGAAACCAACTCCGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143031    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-1839s1c1
Sequence:CCGGCAAACAGTCATTCCAGGCTTACTCGAGTAAGCCTGGAATGACTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138699.2-1119s1c1
Sequence:CCGGCCACTCAATTTCCAGTACCATCTCGAGATGGTACTGGAAATTGAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_138699.2-1157s1c1
Sequence:CCGGGCATTAGATGGTCAGGTGTATCTCGAGATACACCTGACCATCTAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138699.2-1010s1c1
Sequence:CCGGCGAACTGTGTTCACCTGATAACTCGAGTTATCAGGTGAACACAGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138699.2-683s1c1
Sequence:CCGGGCGGAGTTGGTTTCATTCTTTCTCGAGAAAGAATGAAACCAACTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_138699.2-1375s1c1
Sequence:CCGGGAGAGACTTGAGGTTAGAGTTCTCGAGAACTCTAACCTCAAGTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138699.2-1398s1c1
Sequence:CCGGGCAAGTGAGAAGACACTACATCTCGAGATGTAGTGTCTTCTCACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-1234s1c1
Sequence:CCGGCGTAAAGGAATATGGCCTATACTCGAGTATAGGCCATATTCCTTTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145507    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-971s1c1
Sequence:CCGGGATGAATTTCTCCCACTTGTACTCGAGTACAAGTGGGAGAAATTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-968s1c1
Sequence:CCGGGATGATGAATTTCTCCCACTTCTCGAGAAGTGGGAGAAATTCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138699
VALIDATED
LOC93622 MISSION shRNA Lentiviral Transduction Particles
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-1464s1c1
Sequence:CCGGGAATGCGACTTTGGATGAGATCTCGAGATCTCATCCAAAGTCGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-1838s1c1
Sequence:CCGGCCAAACAGTCATTCCAGGCTTCTCGAGAAGCCTGGAATGACTGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138699.2-1053s1c1
Sequence:CCGGGCTCAAACCAAGAGAGCCTTTCTCGAGAAAGGCTCTCTTGGTTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_138699.2-682s1c1
Sequence:CCGGCGCGGAGTTGGTTTCATTCTTCTCGAGAAGAATGAAACCAACTCCGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143031    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-1839s1c1
Sequence:CCGGCAAACAGTCATTCCAGGCTTACTCGAGTAAGCCTGGAATGACTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138699.2-1119s1c1
Sequence:CCGGCCACTCAATTTCCAGTACCATCTCGAGATGGTACTGGAAATTGAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_138699.2-1157s1c1
Sequence:CCGGGCATTAGATGGTCAGGTGTATCTCGAGATACACCTGACCATCTAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138699.2-1010s1c1
Sequence:CCGGCGAACTGTGTTCACCTGATAACTCGAGTTATCAGGTGAACACAGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138699.2-683s1c1
Sequence:CCGGGCGGAGTTGGTTTCATTCTTTCTCGAGAAAGAATGAAACCAACTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_138699.2-1375s1c1
Sequence:CCGGGAGAGACTTGAGGTTAGAGTTCTCGAGAACTCTAACCTCAAGTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138699.2-1398s1c1
Sequence:CCGGGCAAGTGAGAAGACACTACATCTCGAGATGTAGTGTCTTCTCACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145556    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-1234s1c1
Sequence:CCGGCGTAAAGGAATATGGCCTATACTCGAGTATAGGCCATATTCCTTTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145507    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-971s1c1
Sequence:CCGGGATGAATTTCTCCCACTTGTACTCGAGTACAAGTGGGAGAAATTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138699.2-968s1c1
Sequence:CCGGGATGATGAATTTCTCCCACTTCTCGAGAAGTGGGAGAAATTCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)