EMAIL THIS PAGE TO A FRIEND

LOH12CR1

loss of heterozygosity, 12, chromosomal region 1

56 Gene Product Result for
Synonyms: LOH1CR12
UniProtKB ID: Q969J3, Q96QS5
Gene ID:
Mouse(67774) loss of heterozygosity, 12, chromosomal region 1 homolog (human)
Rat(362452) loss of heterozygosity, 12, chromosomal region 1
Zebrafish(449650) loss of heterozygosity, 12, chromosomal region 1 homolog (human)
cow(614947) loss of heterozygosity, 12, chromosomal region 1
domestic cat(101091540) loss of heterozygosity, 12, chromosomal region 1
dog(486684) loss of heterozygosity, 12, chromosomal region 1
chicken(426116) loss of heterozygosity, 12, chromosomal region 1
sheep(101112472) loss of heterozygosity, 12, chromosomal region 1
domestic guinea pig(100728332) loss of heterozygosity, 12, chromosomal region 1
naked mole-rat(101701817) loss of heterozygosity, 12, chromosomal region 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026371 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026371 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026371 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_058169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058169 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU008241 MISSION® esiRNA esiRNA targeting mouse Loh12cr1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058169 Rosetta Predictions human pricing
NM_001108650 Rosetta Predictions rat pricing
NM_026371 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187057 predicted 973
2 SASI_Hs01_00187058 predicted 411
3 SASI_Hs01_00187059 predicted 675
4 SASI_Hs02_00362068 predicted 393
5 SASI_Hs01_00187060 predicted 484
6 SASI_Hs02_00362069 predicted 749
7 SASI_Hs01_00187061 predicted 396
8 SASI_Hs01_00187062 predicted 372
9 SASI_Hs01_00187064 predicted 473
10 SASI_Hs02_00362070 predicted 629
11 SASI_Hs01_00187063 predicted 563
12 SASI_Hs01_00187065 predicted 413
13 SASI_Hs01_00187066 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108650 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240719 predicted 483
2 SASI_Rn02_00240720 predicted 674
3 SASI_Rn02_00240721 predicted 478
4 SASI_Rn02_00240722 predicted 729
5 SASI_Rn02_00240723 predicted 721
6 SASI_Rn02_00240724 predicted 924
7 SASI_Rn02_00240725 predicted 509
8 SASI_Rn02_00240726 predicted 721
9 SASI_Rn02_00240727 predicted 737
10 SASI_Rn02_00240728 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140209 predicted 445
2 SASI_Mm01_00140210 predicted 1273
3 SASI_Mm01_00140211 predicted 916
4 SASI_Mm01_00140212 predicted 946
5 SASI_Mm01_00140213 predicted 1042
6 SASI_Mm01_00140214 predicted 1238
7 SASI_Mm01_00140215 predicted 296
8 SASI_Mm01_00140216 predicted 954
9 SASI_Mm01_00140217 predicted 897
10 SASI_Mm01_00140218 predicted 563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026371
LOH12CR1 MISSION shRNA Bacterial Glycerol Stock
loss of heterozygosity, 12, chromosomal region 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026371.2-649s1c1
Sequence:CCGGGAGCAGATCCAGAAGGTGAATCTCGAGATTCACCTTCTGGATCTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026371.2-552s1c1
Sequence:CCGGGAATGCTCTAGTCAAGCGAATCTCGAGATTCGCTTGACTAGAGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026371.2-567s1c1
Sequence:CCGGGCGAATCAAAGAGATGGATCTCTCGAGAGATCCATCTCTTTGATTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026371.2-1093s1c1
Sequence:CCGGCTCTCTGATCTGTGGCTGTAACTCGAGTTACAGCCACAGATCAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026371.2-546s1c1
Sequence:CCGGCGATCAGAATGCTCTAGTCAACTCGAGTTGACTAGAGCATTCTGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026371.2-556s1c1
Sequence:CCGGGCTCTAGTCAAGCGAATCAAACTCGAGTTTGATTCGCTTGACTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216315    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026371.2-917s1c1
Sequence:CCGGGAAGTTGGGACAGTTGAATTTCTCGAGAAATTCAACTGTCCCAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026371
LOH12CR1 MISSION shRNA shRNA Plasmid DNA
loss of heterozygosity, 12, chromosomal region 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026371.2-649s1c1
Sequence:CCGGGAGCAGATCCAGAAGGTGAATCTCGAGATTCACCTTCTGGATCTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026371.2-552s1c1
Sequence:CCGGGAATGCTCTAGTCAAGCGAATCTCGAGATTCGCTTGACTAGAGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026371.2-567s1c1
Sequence:CCGGGCGAATCAAAGAGATGGATCTCTCGAGAGATCCATCTCTTTGATTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026371.2-1093s1c1
Sequence:CCGGCTCTCTGATCTGTGGCTGTAACTCGAGTTACAGCCACAGATCAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026371.2-546s1c1
Sequence:CCGGCGATCAGAATGCTCTAGTCAACTCGAGTTGACTAGAGCATTCTGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026371.2-556s1c1
Sequence:CCGGGCTCTAGTCAAGCGAATCAAACTCGAGTTTGATTCGCTTGACTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216315    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026371.2-917s1c1
Sequence:CCGGGAAGTTGGGACAGTTGAATTTCTCGAGAAATTCAACTGTCCCAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026371
LOH12CR1 MISSION shRNA Lentiviral Transduction Particles
loss of heterozygosity, 12, chromosomal region 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026371.2-649s1c1
Sequence:CCGGGAGCAGATCCAGAAGGTGAATCTCGAGATTCACCTTCTGGATCTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026371.2-552s1c1
Sequence:CCGGGAATGCTCTAGTCAAGCGAATCTCGAGATTCGCTTGACTAGAGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026371.2-567s1c1
Sequence:CCGGGCGAATCAAAGAGATGGATCTCTCGAGAGATCCATCTCTTTGATTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026371.2-1093s1c1
Sequence:CCGGCTCTCTGATCTGTGGCTGTAACTCGAGTTACAGCCACAGATCAGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026371.2-546s1c1
Sequence:CCGGCGATCAGAATGCTCTAGTCAACTCGAGTTGACTAGAGCATTCTGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026371.2-556s1c1
Sequence:CCGGGCTCTAGTCAAGCGAATCAAACTCGAGTTTGATTCGCTTGACTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216315    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026371.2-917s1c1
Sequence:CCGGGAAGTTGGGACAGTTGAATTTCTCGAGAAATTCAACTGTCCCAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058169
LOH12CR1 MISSION shRNA Bacterial Glycerol Stock
loss of heterozygosity, 12, chromosomal region 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058169.2-614s1c1
Sequence:CCGGCGATATCAAGATCACCTGCATCTCGAGATGCAGGTGATCTTGATATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172436    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058169.2-1122s1c1
Sequence:CCGGCCTAACCAGTTCTCGGTGATACTCGAGTATCACCGAGAACTGGTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172460    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058169.2-1135s1c1
Sequence:CCGGCGGTGATAACTGAAGCTGGAACTCGAGTTCCAGCTTCAGTTATCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058169.2-499s1c1
Sequence:CCGGGCAAGAGATTCCAACCTTCCACTCGAGTGGAAGGTTGGAATCTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058169.3-726s21c1
Sequence:CCGGGATGGATCTGTCTGTAGAAACCTCGAGGTTTCTACAGACAGATCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058169.3-694s21c1
Sequence:CCGGGACCAGAATGCTTTGGTTAAACTCGAGTTTAACCAAAGCATTCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058169
LOH12CR1 MISSION shRNA shRNA Plasmid DNA
loss of heterozygosity, 12, chromosomal region 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058169.2-614s1c1
Sequence:CCGGCGATATCAAGATCACCTGCATCTCGAGATGCAGGTGATCTTGATATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172436    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058169.2-1122s1c1
Sequence:CCGGCCTAACCAGTTCTCGGTGATACTCGAGTATCACCGAGAACTGGTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172460    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058169.2-1135s1c1
Sequence:CCGGCGGTGATAACTGAAGCTGGAACTCGAGTTCCAGCTTCAGTTATCACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058169.2-499s1c1
Sequence:CCGGGCAAGAGATTCCAACCTTCCACTCGAGTGGAAGGTTGGAATCTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058169.3-726s21c1
Sequence:CCGGGATGGATCTGTCTGTAGAAACCTCGAGGTTTCTACAGACAGATCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058169.3-694s21c1
Sequence:CCGGGACCAGAATGCTTTGGTTAAACTCGAGTTTAACCAAAGCATTCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058169
LOH12CR1 MISSION shRNA Lentiviral Transduction Particles
loss of heterozygosity, 12, chromosomal region 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058169.2-614s1c1
Sequence:CCGGCGATATCAAGATCACCTGCATCTCGAGATGCAGGTGATCTTGATATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172436    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058169.2-1122s1c1
Sequence:CCGGCCTAACCAGTTCTCGGTGATACTCGAGTATCACCGAGAACTGGTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172460    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058169.2-1135s1c1
Sequence:CCGGCGGTGATAACTGAAGCTGGAACTCGAGTTCCAGCTTCAGTTATCACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058169.2-499s1c1
Sequence:CCGGGCAAGAGATTCCAACCTTCCACTCGAGTGGAAGGTTGGAATCTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058169.3-726s21c1
Sequence:CCGGGATGGATCTGTCTGTAGAAACCTCGAGGTTTCTACAGACAGATCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058169.3-694s21c1
Sequence:CCGGGACCAGAATGCTTTGGTTAAACTCGAGTTTAACCAAAGCATTCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)