EMAIL THIS PAGE TO A FRIEND

LONP1

lon peptidase 1, mitochondrial

139 Gene Product Result for
Synonyms: LON LONP LonHS PIM1 PRSS15 hLON
UniProtKB ID: P36776, D6W635, E5KMH8, P36777, Q9UQ95
Gene ID:
Human(9361) Summary: This gene encodes a mitochondrial matrix protein that belongs to the Lon family of ATP-dependent proteases. This protein mediates the selective degradation of misfolded, unassembled or oxidatively damaged polypeptides in the mitochondrial matrix. It may also have a chaperone function in the assembly of inner membrane protein complexes, and participate in the regulation of mitochondrial gene expression and maintenance of the integrity of the mitochondrial genome. Decreased expression of this gene has been noted in a patient with hereditary spastic paraplegia (PMID:18378094). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
Mouse(74142) lon peptidase 1, mitochondrial
Rat(170916) lon peptidase 1, mitochondrial
Zebrafish(563257) lon peptidase 1, mitochondrial
domestic cat(101093417) lon peptidase 1, mitochondrial
cow(510796) lon peptidase 1, mitochondrial
dog(611425) lon peptidase 1, mitochondrial
chicken(768942) lon peptidase 1, mitochondrial
sheep(101109965) lon peptidase 1, mitochondrial
naked mole-rat(101710908) lon peptidase 1, mitochondrial
domestic guinea pig(100717869) lon peptidase 1, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028782 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028782 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028782 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004793 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004793 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004793 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_128721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004793 Rosetta Predictions human pricing
NM_133404 Rosetta Predictions rat pricing
NM_028782 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202287 predicted 2770
2 SASI_Hs01_00202288 predicted 2247
3 SASI_Hs01_00202289 predicted 592
4 SASI_Hs01_00202290 predicted 1085
5 SASI_Hs01_00202291 predicted 925
6 SASI_Hs02_00338319 predicted 2187
7 SASI_Hs01_00202292 predicted 2271
8 SASI_Hs01_00202293 predicted 2663
9 SASI_Hs01_00202294 predicted 656
10 SASI_Hs01_00202295 predicted 2169
11 SASI_Hs01_00202296 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061172 predicted 1219
2 SASI_Rn02_00267661 predicted 2185
3 SASI_Rn02_00267662 predicted 447
4 SASI_Rn01_00061173 predicted 566
5 SASI_Rn01_00061174 predicted 1720
6 SASI_Rn01_00061175 predicted 1593
7 SASI_Rn01_00061176 predicted 374
8 SASI_Rn01_00061177 predicted 2398
9 SASI_Rn01_00061178 predicted 2055
10 SASI_Rn01_00061181 predicted 1708
11 SASI_Rn01_00061179 predicted 1044
12 SASI_Rn01_00061180 predicted 1606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028782 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082186 predicted 1957
2 SASI_Mm01_00082187 predicted 1054
3 SASI_Mm01_00082188 predicted 2560
4 SASI_Mm01_00082189 predicted 1888
5 SASI_Mm01_00082190 predicted 401
6 SASI_Mm01_00082191 predicted 2425
7 SASI_Mm01_00082185 predicted 606
8 SASI_Mm01_00082192 predicted 2190
9 SASI_Mm02_00334388 predicted 473
10 SASI_Mm01_00082194 predicted 383
11 SASI_Mm01_00082193 predicted 1725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028782
LONP1 MISSION shRNA Bacterial Glycerol Stock
lon peptidase 1, mitochondrial
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000351900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028782.2-536s21c1
Sequence:CCGGGCCTGGATGAAATCTACCATACTCGAGTATGGTAGATTTCATCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028782.2-594s21c1
Sequence:CCGGCGGAGACAAGTTGCGAATGATCTCGAGATCATTCGCAACTTGTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028782.2-2803s21c1
Sequence:CCGGGTGGAACACTATCGGGACATACTCGAGTATGTCCCGATAGTGTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028782.2-1191s21c1
Sequence:CCGGGCAGTTGAAGATCATCAAGAACTCGAGTTCTTGATGATCTTCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028782
LONP1 MISSION shRNA shRNA Plasmid DNA
lon peptidase 1, mitochondrial
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000351900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028782.2-536s21c1
Sequence:CCGGGCCTGGATGAAATCTACCATACTCGAGTATGGTAGATTTCATCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028782.2-594s21c1
Sequence:CCGGCGGAGACAAGTTGCGAATGATCTCGAGATCATTCGCAACTTGTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028782.2-2803s21c1
Sequence:CCGGGTGGAACACTATCGGGACATACTCGAGTATGTCCCGATAGTGTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028782.2-1191s21c1
Sequence:CCGGGCAGTTGAAGATCATCAAGAACTCGAGTTCTTGATGATCTTCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028782
LONP1 MISSION shRNA Lentiviral Transduction Particles
lon peptidase 1, mitochondrial
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000351900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028782.2-536s21c1
Sequence:CCGGGCCTGGATGAAATCTACCATACTCGAGTATGGTAGATTTCATCCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000351901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028782.2-594s21c1
Sequence:CCGGCGGAGACAAGTTGCGAATGATCTCGAGATCATTCGCAACTTGTCTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000351903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028782.2-2803s21c1
Sequence:CCGGGTGGAACACTATCGGGACATACTCGAGTATGTCCCGATAGTGTTCCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000351975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028782.2-1191s21c1
Sequence:CCGGGCAGTTGAAGATCATCAAGAACTCGAGTTCTTGATGATCTTCAACTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004793
VALIDATED
LONP1 MISSION shRNA Bacterial Glycerol Stock
lon peptidase 1, mitochondrial
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004793.2-513s21c1
Sequence:CCGGCCAGCCTTATGTCGGCGTCTTCTCGAGAAGACGCCGACATAAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004793.2-2775s21c1
Sequence:CCGGCGAGAACAAGAAGGACTTCTACTCGAGTAGAAGTCCTTCTTGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004793.2-1227s21c1
Sequence:CCGGGCAGCTAAAGATCATCAAGAACTCGAGTTCTTGATGATCTTTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004793.2-1755s21c1
Sequence:CCGGCCAGTGTTTGAAGAAGACCAACTCGAGTTGGTCTTCTTCAAACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004793.2-1227s1c1
Sequence:CCGGGCAGCTAAAGATCATCAAGAACTCGAGTTCTTGATGATCTTTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004793.2-2775s1c1
Sequence:CCGGCGAGAACAAGAAGGACTTCTACTCGAGTAGAAGTCCTTCTTGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004793.2-2360s1c1
Sequence:CCGGCCACGCTGTTTGTGGAGACATCTCGAGATGTCTCCACAAACAGCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004793.2-1755s1c1
Sequence:CCGGCCAGTGTTTGAAGAAGACCAACTCGAGTTGGTCTTCTTCAAACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004793.2-513s1c1
Sequence:CCGGCCAGCCTTATGTCGGCGTCTTCTCGAGAAGACGCCGACATAAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004793
VALIDATED
LONP1 MISSION shRNA shRNA Plasmid DNA
lon peptidase 1, mitochondrial
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004793.2-513s21c1
Sequence:CCGGCCAGCCTTATGTCGGCGTCTTCTCGAGAAGACGCCGACATAAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004793.2-2775s21c1
Sequence:CCGGCGAGAACAAGAAGGACTTCTACTCGAGTAGAAGTCCTTCTTGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004793.2-1227s21c1
Sequence:CCGGGCAGCTAAAGATCATCAAGAACTCGAGTTCTTGATGATCTTTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004793.2-1755s21c1
Sequence:CCGGCCAGTGTTTGAAGAAGACCAACTCGAGTTGGTCTTCTTCAAACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004793.2-1227s1c1
Sequence:CCGGGCAGCTAAAGATCATCAAGAACTCGAGTTCTTGATGATCTTTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004793.2-2775s1c1
Sequence:CCGGCGAGAACAAGAAGGACTTCTACTCGAGTAGAAGTCCTTCTTGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004793.2-2360s1c1
Sequence:CCGGCCACGCTGTTTGTGGAGACATCTCGAGATGTCTCCACAAACAGCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004793.2-1755s1c1
Sequence:CCGGCCAGTGTTTGAAGAAGACCAACTCGAGTTGGTCTTCTTCAAACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004793.2-513s1c1
Sequence:CCGGCCAGCCTTATGTCGGCGTCTTCTCGAGAAGACGCCGACATAAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004793
VALIDATED
LONP1 MISSION shRNA Lentiviral Transduction Particles
lon peptidase 1, mitochondrial
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004793.2-513s21c1
Sequence:CCGGCCAGCCTTATGTCGGCGTCTTCTCGAGAAGACGCCGACATAAGGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000291804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004793.2-2775s21c1
Sequence:CCGGCGAGAACAAGAAGGACTTCTACTCGAGTAGAAGTCCTTCTTGTTCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000291877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004793.2-1227s21c1
Sequence:CCGGGCAGCTAAAGATCATCAAGAACTCGAGTTCTTGATGATCTTTAGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000291803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004793.2-1755s21c1
Sequence:CCGGCCAGTGTTTGAAGAAGACCAACTCGAGTTGGTCTTCTTCAAACACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000046794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004793.2-1227s1c1
Sequence:CCGGGCAGCTAAAGATCATCAAGAACTCGAGTTCTTGATGATCTTTAGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000046795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004793.2-2775s1c1
Sequence:CCGGCGAGAACAAGAAGGACTTCTACTCGAGTAGAAGTCCTTCTTGTTCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000046796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004793.2-2360s1c1
Sequence:CCGGCCACGCTGTTTGTGGAGACATCTCGAGATGTCTCCACAAACAGCGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000046793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004793.2-1755s1c1
Sequence:CCGGCCAGTGTTTGAAGAAGACCAACTCGAGTTGGTCTTCTTCAAACACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000046797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004793.2-513s1c1
Sequence:CCGGCCAGCCTTATGTCGGCGTCTTCTCGAGAAGACGCCGACATAAGGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128721
VALIDATED
LONP1 MISSION shRNA Bacterial Glycerol Stock
lon peptidase 1, mitochondrial
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128721.2-2353s1c1
Sequence:CCGGCCTGAGAACCTACAAGACTTTCTCGAGAAAGTCTTGTAGGTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128721.2-735s1c1
Sequence:CCGGCGGAGACAAGTTGCGAATGATCTCGAGATCATTCGCAACTTGTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128721.2-677s1c1
Sequence:CCGGGCCTGGATGAAATCTACCATACTCGAGTATGGTAGATTTCATCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128721.2-2944s1c1
Sequence:CCGGGTGGAACACTATCGGGACATACTCGAGTATGTCCCGATAGTGTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128721.2-1332s1c1
Sequence:CCGGGCAGTTGAAGATCATCAAGAACTCGAGTTCTTGATGATCTTCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128721
VALIDATED
LONP1 MISSION shRNA shRNA Plasmid DNA
lon peptidase 1, mitochondrial
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128721.2-2353s1c1
Sequence:CCGGCCTGAGAACCTACAAGACTTTCTCGAGAAAGTCTTGTAGGTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128721.2-735s1c1
Sequence:CCGGCGGAGACAAGTTGCGAATGATCTCGAGATCATTCGCAACTTGTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128721.2-677s1c1
Sequence:CCGGGCCTGGATGAAATCTACCATACTCGAGTATGGTAGATTTCATCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128721.2-2944s1c1
Sequence:CCGGGTGGAACACTATCGGGACATACTCGAGTATGTCCCGATAGTGTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128721.2-1332s1c1
Sequence:CCGGGCAGTTGAAGATCATCAAGAACTCGAGTTCTTGATGATCTTCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128721
VALIDATED
LONP1 MISSION shRNA Lentiviral Transduction Particles
lon peptidase 1, mitochondrial
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128721.2-2353s1c1
Sequence:CCGGCCTGAGAACCTACAAGACTTTCTCGAGAAAGTCTTGTAGGTTCTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000033152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128721.2-735s1c1
Sequence:CCGGCGGAGACAAGTTGCGAATGATCTCGAGATCATTCGCAACTTGTCTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000033149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128721.2-677s1c1
Sequence:CCGGGCCTGGATGAAATCTACCATACTCGAGTATGGTAGATTTCATCCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000033153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128721.2-2944s1c1
Sequence:CCGGGTGGAACACTATCGGGACATACTCGAGTATGTCCCGATAGTGTTCCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000033151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128721.2-1332s1c1
Sequence:CCGGGCAGTTGAAGATCATCAAGAACTCGAGTTCTTGATGATCTTCAACTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???