EMAIL THIS PAGE TO A FRIEND

LONRF2

LON peptidase N-terminal domain and ring finger 2

95 Gene Product Result for
Synonyms: RNF192
UniProtKB ID: Q1L5Z9, B9A006, Q6ZSR4
Gene ID:
Mouse(381338) LON peptidase N-terminal domain and ring finger 2
Rat(301361) LON peptidase N-terminal domain and ring finger 2
chicken(418706) LON peptidase N-terminal domain and ring finger 2
dog(481336) LON peptidase N-terminal domain and ring finger 2
cow(787650) LON peptidase N-terminal domain and ring finger 2
domestic cat(101095331) LON peptidase N-terminal domain and ring finger 2
sheep(101111088) LON peptidase N-terminal domain and ring finger 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198461 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001029878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037651 MISSION® esiRNA esiRNA human LONRF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198461 Rosetta Predictions human pricing
XM_001058206 Rosetta Predictions rat pricing
XM_237078 Rosetta Predictions rat pricing
NM_001029878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027226 predicted 1537
2 SASI_Hs01_00027228 predicted 2517
3 SASI_Hs01_00027229 predicted 2821
4 SASI_Hs02_00371985 predicted 1374
5 SASI_Hs02_00371986 predicted 1429
6 SASI_Hs02_00371987 predicted 2096
7 SASI_Hs01_00027230 predicted 2960
8 SASI_Hs02_00371988 predicted 1489
9 SASI_Hs01_00027231 predicted 2131
10 SASI_Hs01_00027232 predicted 1621
11 SASI_Hs01_00027227 predicted 1684
12 SASI_Hs01_00027233 predicted 856
13 SASI_Hs01_00027234 predicted 400
14 SASI_Hs01_00027235 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288969 predicted 1137
2 SASI_Rn02_00288970 predicted 1632
3 SASI_Rn02_00288971 predicted 1797
4 SASI_Rn02_00288972 predicted 1351
5 SASI_Rn02_00288973 predicted 2276
6 SASI_Rn02_00288974 predicted 1874
7 SASI_Rn02_00288975 predicted 1610
8 SASI_Rn02_00288976 predicted 1252
9 SASI_Rn02_00288977 predicted 2032
10 SASI_Rn02_00288978 predicted 1626
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390637 predicted 1140
2 SASI_Rn02_00390638 predicted 1629
3 SASI_Rn02_00390639 predicted 1800
4 SASI_Rn02_00390640 predicted 1347
5 SASI_Rn02_00390641 predicted 2277
6 SASI_Rn02_00390642 predicted 1878
7 SASI_Rn02_00390643 predicted 1607
8 SASI_Rn02_00390644 predicted 1249
9 SASI_Rn02_00390645 predicted 2028
10 SASI_Rn02_00390646 predicted 1628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047431 predicted 325
2 SASI_Mm01_00047432 predicted 618
3 SASI_Mm02_00288047 predicted 222
4 SASI_Mm01_00047433 predicted 1051
5 SASI_Mm01_00047434 predicted 806
6 SASI_Mm01_00047435 predicted 1069
7 SASI_Mm01_00047436 predicted 338
8 SASI_Mm01_00047437 predicted 374
9 SASI_Mm01_00047438 predicted 694
10 SASI_Mm01_00047439 predicted 275
11 SASI_Mm01_00047430 predicted 615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198461
LONRF2 MISSION shRNA Bacterial Glycerol Stock
LON peptidase N-terminal domain and ring finger 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198461.1-531s1c1
Sequence:CCGGGCTGGCTTAAAGAGACAGTTTCTCGAGAAACTGTCTCTTTAAGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198461.1-126s1c1
Sequence:CCGGCCTCTCTTGATTAAGGGACATCTCGAGATGTCCCTTAATCAAGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198461.1-1529s1c1
Sequence:CCGGCCGACGGATATTAGTCATCATCTCGAGATGATGACTAATATCCGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198461.1-825s1c1
Sequence:CCGGGCAAGCAGAAACTTTAACATACTCGAGTATGTTAAAGTTTCTGCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198461.1-1987s1c1
Sequence:CCGGCGTGCTTTAGTGTGTAGACAACTCGAGTTGTCTACACACTAAAGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198461.3-1618s21c1
Sequence:CCGGTTCCATCCAAAGCAGATTAAACTCGAGTTTAATCTGCTTTGGATGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198461.3-3217s21c1
Sequence:CCGGGGTTTGGGTTTCACGAGAAAGCTCGAGCTTTCTCGTGAAACCCAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198461.3-2520s21c1
Sequence:CCGGGCTATAACACAGCGGACATTGCTCGAGCAATGTCCGCTGTGTTATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198461
LONRF2 MISSION shRNA shRNA Plasmid DNA
LON peptidase N-terminal domain and ring finger 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198461.1-531s1c1
Sequence:CCGGGCTGGCTTAAAGAGACAGTTTCTCGAGAAACTGTCTCTTTAAGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198461.1-126s1c1
Sequence:CCGGCCTCTCTTGATTAAGGGACATCTCGAGATGTCCCTTAATCAAGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198461.1-1529s1c1
Sequence:CCGGCCGACGGATATTAGTCATCATCTCGAGATGATGACTAATATCCGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198461.1-825s1c1
Sequence:CCGGGCAAGCAGAAACTTTAACATACTCGAGTATGTTAAAGTTTCTGCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198461.1-1987s1c1
Sequence:CCGGCGTGCTTTAGTGTGTAGACAACTCGAGTTGTCTACACACTAAAGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198461.3-1618s21c1
Sequence:CCGGTTCCATCCAAAGCAGATTAAACTCGAGTTTAATCTGCTTTGGATGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198461.3-3217s21c1
Sequence:CCGGGGTTTGGGTTTCACGAGAAAGCTCGAGCTTTCTCGTGAAACCCAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198461.3-2520s21c1
Sequence:CCGGGCTATAACACAGCGGACATTGCTCGAGCAATGTCCGCTGTGTTATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198461
LONRF2 MISSION shRNA Lentiviral Transduction Particles
LON peptidase N-terminal domain and ring finger 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198461.1-531s1c1
Sequence:CCGGGCTGGCTTAAAGAGACAGTTTCTCGAGAAACTGTCTCTTTAAGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198461.1-126s1c1
Sequence:CCGGCCTCTCTTGATTAAGGGACATCTCGAGATGTCCCTTAATCAAGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198461.1-1529s1c1
Sequence:CCGGCCGACGGATATTAGTCATCATCTCGAGATGATGACTAATATCCGTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198461.1-825s1c1
Sequence:CCGGGCAAGCAGAAACTTTAACATACTCGAGTATGTTAAAGTTTCTGCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198461.1-1987s1c1
Sequence:CCGGCGTGCTTTAGTGTGTAGACAACTCGAGTTGTCTACACACTAAAGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198461.3-1618s21c1
Sequence:CCGGTTCCATCCAAAGCAGATTAAACTCGAGTTTAATCTGCTTTGGATGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198461.3-3217s21c1
Sequence:CCGGGGTTTGGGTTTCACGAGAAAGCTCGAGCTTTCTCGTGAAACCCAAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198461.3-2520s21c1
Sequence:CCGGGCTATAACACAGCGGACATTGCTCGAGCAATGTCCGCTGTGTTATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029878
LONRF2 MISSION shRNA Bacterial Glycerol Stock
LON peptidase N-terminal domain and ring finger 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029878.1-189s1c1
Sequence:CCGGGAAGGTAATATGTGAGGTGTTCTCGAGAACACCTCACATATTACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029878.1-1480s1c1
Sequence:CCGGCGACGAATATTAGTCATCATTCTCGAGAATGATGACTAATATTCGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029878.1-4805s1c1
Sequence:CCGGGCTGACATTATGGAGGCTTTACTCGAGTAAAGCCTCCATAATGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029878.1-802s21c1
Sequence:CCGGCTGACTGAAGAGCTGATATTCCTCGAGGAATATCAGCTCTTCAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029878.1-512s21c1
Sequence:CCGGATGAGGAGCTCAAAGCGAATACTCGAGTATTCGCTTTGAGCTCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029878.1-845s21c1
Sequence:CCGGCTGACAGGAAGAGGGTCTATGCTCGAGCATAGACCCTCTTCCTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029878.1-1481s21c1
Sequence:CCGGGACGAATATTAGTCATCATTACTCGAGTAATGATGACTAATATTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029878
LONRF2 MISSION shRNA shRNA Plasmid DNA
LON peptidase N-terminal domain and ring finger 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029878.1-189s1c1
Sequence:CCGGGAAGGTAATATGTGAGGTGTTCTCGAGAACACCTCACATATTACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029878.1-1480s1c1
Sequence:CCGGCGACGAATATTAGTCATCATTCTCGAGAATGATGACTAATATTCGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029878.1-4805s1c1
Sequence:CCGGGCTGACATTATGGAGGCTTTACTCGAGTAAAGCCTCCATAATGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029878.1-802s21c1
Sequence:CCGGCTGACTGAAGAGCTGATATTCCTCGAGGAATATCAGCTCTTCAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029878.1-512s21c1
Sequence:CCGGATGAGGAGCTCAAAGCGAATACTCGAGTATTCGCTTTGAGCTCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029878.1-845s21c1
Sequence:CCGGCTGACAGGAAGAGGGTCTATGCTCGAGCATAGACCCTCTTCCTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029878.1-1481s21c1
Sequence:CCGGGACGAATATTAGTCATCATTACTCGAGTAATGATGACTAATATTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029878
LONRF2 MISSION shRNA Lentiviral Transduction Particles
LON peptidase N-terminal domain and ring finger 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029878.1-189s1c1
Sequence:CCGGGAAGGTAATATGTGAGGTGTTCTCGAGAACACCTCACATATTACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029878.1-1480s1c1
Sequence:CCGGCGACGAATATTAGTCATCATTCTCGAGAATGATGACTAATATTCGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029878.1-4805s1c1
Sequence:CCGGGCTGACATTATGGAGGCTTTACTCGAGTAAAGCCTCCATAATGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029878.1-802s21c1
Sequence:CCGGCTGACTGAAGAGCTGATATTCCTCGAGGAATATCAGCTCTTCAGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029878.1-512s21c1
Sequence:CCGGATGAGGAGCTCAAAGCGAATACTCGAGTATTCGCTTTGAGCTCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029878.1-845s21c1
Sequence:CCGGCTGACAGGAAGAGGGTCTATGCTCGAGCATAGACCCTCTTCCTGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029878.1-1481s21c1
Sequence:CCGGGACGAATATTAGTCATCATTACTCGAGTAATGATGACTAATATTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)