EMAIL THIS PAGE TO A FRIEND

LONRF3

LON peptidase N-terminal domain and ring finger 3

89 Gene Product Result for
Synonyms: RNF127
UniProtKB ID: Q496Y0, Q5JPN6, Q8NB00, Q9H647
Gene ID:
Human(79836) Summary: The protein encoded by this gene contains a RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. Multiple alternatively spliced transcript variants have been suggested, but their full length natures are not clear. [provided by RefSeq, Jul 2008]
Mouse(74365) LON peptidase N-terminal domain and ring finger 3
Rat(298322) LON peptidase N-terminal domain and ring finger 3
chicken(422375) LON peptidase N-terminal domain and ring finger 3
cow(508189) LON peptidase N-terminal domain and ring finger 3
Horse(100053629) LON peptidase N-terminal domain and ring finger 3
dog(100687354) LON peptidase N-terminal domain and ring finger 3
domestic cat(101091852) LON peptidase N-terminal domain and ring finger 3
sheep(101104461) LON peptidase N-terminal domain and ring finger 3
domestic guinea pig(100728878) LON peptidase N-terminal domain and ring finger 3
naked mole-rat(101724684) LON peptidase N-terminal domain and ring finger 3
Domestic Rabbit(100352541) LON peptidase N-terminal domain and ring finger 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024778 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024778 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024778 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028894 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028894 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028894 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031855 Rosetta Predictions human pricing
NM_024778 Rosetta Predictions human pricing
XM_233279 Rosetta Predictions rat pricing
XR_007981 Rosetta Predictions rat pricing
NM_028894 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198806 predicted 1287
2 SASI_Hs01_00198807 predicted 2377
3 SASI_Hs01_00198809 predicted 1377
4 SASI_Hs02_00307858 predicted 1289
5 SASI_Hs01_00198810 predicted 2232
6 SASI_Hs01_00198811 predicted 1520
7 SASI_Hs01_00198812 predicted 1438
8 SASI_Hs01_00198813 predicted 1968
9 SASI_Hs02_00307859 predicted 1756
10 SASI_Hs02_00307860 predicted 1375
11 SASI_Hs01_00198808 predicted 1344
12 SASI_Hs01_00198814 predicted 1803
13 SASI_Hs01_00198815 predicted 1388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185722 predicted 1167
2 SASI_Hs01_00185723 predicted 2258
3 SASI_Hs01_00185725 predicted 1250
4 SASI_Hs02_00357298 predicted 1163
5 SASI_Hs01_00185726 predicted 2109
6 SASI_Hs01_00185727 predicted 1395
7 SASI_Hs01_00185728 predicted 1311
8 SASI_Hs01_00185729 predicted 1846
9 SASI_Hs02_00357299 predicted 1628
10 SASI_Hs02_00357300 predicted 1251
11 SASI_Hs01_00185724 predicted 1222
12 SASI_Hs01_00185730 predicted 1687
13 SASI_Hs01_00185731 predicted 1269
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387592 predicted 896
2 SASI_Rn02_00387593 predicted 746
3 SASI_Rn02_00387594 predicted 910
4 SASI_Rn02_00387595 predicted 803
5 SASI_Rn02_00387596 predicted 587
6 SASI_Rn02_00387597 predicted 683
7 SASI_Rn02_00387598 predicted 694
8 SASI_Rn02_00387599 predicted 901
9 SASI_Rn02_00387600 predicted 344
10 SASI_Rn02_00387601 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00415980 predicted 1932
2 SASI_Rn01_00152274 predicted 1241
3 SASI_Rn02_00415981 predicted 1223
4 SASI_Rn01_00152276 predicted 1833
5 SASI_Rn01_00152277 predicted 1234
6 SASI_Rn01_00152278 predicted 1737
7 SASI_Rn01_00152279 predicted 1656
8 SASI_Rn01_00152280 predicted 1068
9 SASI_Rn02_00415982 predicted 1445
10 SASI_Rn01_00152282 predicted 1790
11 SASI_Rn01_00152275 predicted 1539
12 SASI_Rn01_00152281 predicted 1637
13 SASI_Rn01_00152283 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028894 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334578 predicted 2211
2 SASI_Mm01_00079055 predicted 1409
3 SASI_Mm01_00079058 predicted 997
4 SASI_Mm01_00079059 predicted 2522
5 SASI_Mm01_00079060 predicted 990
6 SASI_Mm01_00079061 predicted 1562
7 SASI_Mm01_00079062 predicted 1166
8 SASI_Mm01_00079063 predicted 1142
9 SASI_Mm02_00334579 predicted 1501
10 SASI_Mm01_00079064 predicted 2346
11 SASI_Mm01_00079056 predicted 1735
12 SASI_Mm01_00079057 predicted 1505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024778
LONRF3 MISSION shRNA Bacterial Glycerol Stock
LON peptidase N-terminal domain and ring finger 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024778.4-872s21c1
Sequence:CCGGAGCAATCGGTCTCAGATTTATCTCGAGATAAATCTGAGACCGATTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024778.4-1947s21c1
Sequence:CCGGTGTGGTTTCATTCGCTCAAATCTCGAGATTTGAGCGAATGAAACCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024778.3-1428s1c1
Sequence:CCGGCTGACCTTGAATGCGCTCTATCTCGAGATAGAGCGCATTCAAGGTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024778.3-1779s1c1
Sequence:CCGGGCCTGATGATTCGTAGATGCACTCGAGTGCATCTACGAATCATCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024778.3-2192s1c1
Sequence:CCGGTGGTGGATGTTAGCAGTTCTTCTCGAGAAGAACTGCTAACATCCACCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024778.3-1208s1c1
Sequence:CCGGCACATGAAAGACCAGGAAGAACTCGAGTTCTTCCTGGTCTTTCATGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024778
LONRF3 MISSION shRNA shRNA Plasmid DNA
LON peptidase N-terminal domain and ring finger 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024778.4-872s21c1
Sequence:CCGGAGCAATCGGTCTCAGATTTATCTCGAGATAAATCTGAGACCGATTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024778.4-1947s21c1
Sequence:CCGGTGTGGTTTCATTCGCTCAAATCTCGAGATTTGAGCGAATGAAACCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024778.3-1428s1c1
Sequence:CCGGCTGACCTTGAATGCGCTCTATCTCGAGATAGAGCGCATTCAAGGTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024778.3-1779s1c1
Sequence:CCGGGCCTGATGATTCGTAGATGCACTCGAGTGCATCTACGAATCATCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024778.3-2192s1c1
Sequence:CCGGTGGTGGATGTTAGCAGTTCTTCTCGAGAAGAACTGCTAACATCCACCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024778.3-1208s1c1
Sequence:CCGGCACATGAAAGACCAGGAAGAACTCGAGTTCTTCCTGGTCTTTCATGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024778
LONRF3 MISSION shRNA Lentiviral Transduction Particles
LON peptidase N-terminal domain and ring finger 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024778.4-872s21c1
Sequence:CCGGAGCAATCGGTCTCAGATTTATCTCGAGATAAATCTGAGACCGATTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024778.4-1947s21c1
Sequence:CCGGTGTGGTTTCATTCGCTCAAATCTCGAGATTTGAGCGAATGAAACCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024778.3-1428s1c1
Sequence:CCGGCTGACCTTGAATGCGCTCTATCTCGAGATAGAGCGCATTCAAGGTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024778.3-1779s1c1
Sequence:CCGGGCCTGATGATTCGTAGATGCACTCGAGTGCATCTACGAATCATCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024778.3-2192s1c1
Sequence:CCGGTGGTGGATGTTAGCAGTTCTTCTCGAGAAGAACTGCTAACATCCACCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024778.3-1208s1c1
Sequence:CCGGCACATGAAAGACCAGGAAGAACTCGAGTTCTTCCTGGTCTTTCATGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028894
VALIDATED
LONRF3 MISSION shRNA Bacterial Glycerol Stock
LON peptidase N-terminal domain and ring finger 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028894.1-1869s1c1
Sequence:CCGGGCACATCTTTGAGCCTTGTTACTCGAGTAACAAGGCTCAAAGATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028894.1-2355s1c1
Sequence:CCGGCCTAGCAATGAGGTCCTTAAACTCGAGTTTAAGGACCTCATTGCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028894.1-5562s1c1
Sequence:CCGGGCTTCTTGATACAATTCCTTTCTCGAGAAAGGAATTGTATCAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028894.1-2216s1c1
Sequence:CCGGCTCTGAAGAATCGGATACTAACTCGAGTTAGTATCCGATTCTTCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028894.1-999s1c1
Sequence:CCGGCGACCATTTGCTTTATAGCAACTCGAGTTGCTATAAAGCAAATGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028894.1-1893s1c1
Sequence:CCGGCCTGATGATTCGGAGATGTATCTCGAGATACATCTCCGAATCATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028894.1-1979s1c1
Sequence:CCGGGCTGCATCTTAGAGATCAGAACTCGAGTTCTGATCTCTAAGATGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028894.1-1444s1c1
Sequence:CCGGGACACAGAATTGCCTAATAAACTCGAGTTTATTAGGCAATTCTGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028894.1-2098s1c1
Sequence:CCGGGCTGACATTGAATACATTGAACTCGAGTTCAATGTATTCAATGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028894
VALIDATED
LONRF3 MISSION shRNA shRNA Plasmid DNA
LON peptidase N-terminal domain and ring finger 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028894.1-1869s1c1
Sequence:CCGGGCACATCTTTGAGCCTTGTTACTCGAGTAACAAGGCTCAAAGATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028894.1-2355s1c1
Sequence:CCGGCCTAGCAATGAGGTCCTTAAACTCGAGTTTAAGGACCTCATTGCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028894.1-5562s1c1
Sequence:CCGGGCTTCTTGATACAATTCCTTTCTCGAGAAAGGAATTGTATCAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028894.1-2216s1c1
Sequence:CCGGCTCTGAAGAATCGGATACTAACTCGAGTTAGTATCCGATTCTTCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028894.1-999s1c1
Sequence:CCGGCGACCATTTGCTTTATAGCAACTCGAGTTGCTATAAAGCAAATGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028894.1-1893s1c1
Sequence:CCGGCCTGATGATTCGGAGATGTATCTCGAGATACATCTCCGAATCATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028894.1-1979s1c1
Sequence:CCGGGCTGCATCTTAGAGATCAGAACTCGAGTTCTGATCTCTAAGATGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028894.1-1444s1c1
Sequence:CCGGGACACAGAATTGCCTAATAAACTCGAGTTTATTAGGCAATTCTGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028894.1-2098s1c1
Sequence:CCGGGCTGACATTGAATACATTGAACTCGAGTTCAATGTATTCAATGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028894
VALIDATED
LONRF3 MISSION shRNA Lentiviral Transduction Particles
LON peptidase N-terminal domain and ring finger 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028894.1-1869s1c1
Sequence:CCGGGCACATCTTTGAGCCTTGTTACTCGAGTAACAAGGCTCAAAGATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028894.1-2355s1c1
Sequence:CCGGCCTAGCAATGAGGTCCTTAAACTCGAGTTTAAGGACCTCATTGCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028894.1-5562s1c1
Sequence:CCGGGCTTCTTGATACAATTCCTTTCTCGAGAAAGGAATTGTATCAAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028894.1-2216s1c1
Sequence:CCGGCTCTGAAGAATCGGATACTAACTCGAGTTAGTATCCGATTCTTCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028894.1-999s1c1
Sequence:CCGGCGACCATTTGCTTTATAGCAACTCGAGTTGCTATAAAGCAAATGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028894.1-1893s1c1
Sequence:CCGGCCTGATGATTCGGAGATGTATCTCGAGATACATCTCCGAATCATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028894.1-1979s1c1
Sequence:CCGGGCTGCATCTTAGAGATCAGAACTCGAGTTCTGATCTCTAAGATGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028894.1-1444s1c1
Sequence:CCGGGACACAGAATTGCCTAATAAACTCGAGTTTATTAGGCAATTCTGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028894.1-2098s1c1
Sequence:CCGGGCTGACATTGAATACATTGAACTCGAGTTCAATGTATTCAATGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)