EMAIL THIS PAGE TO A FRIEND

LOR

loricrin

85 Gene Product Result for
UniProtKB ID: P23490, Q5T869, Q5XKF8
Gene ID:
Human(4014) Summary: This gene encodes loricrin, a major protein component of the cornified cell envelope found in terminally differentiated epidermal cells. Mutations in this gene are associated with Vohwinkel's syndrome and progressive symmetric erythrokeratoderma, both inherited skin diseases. [provided by RefSeq, Jul 2008]
Mouse(16939) loricrin
Rat(502541) loricrin
dog(609440) loricrin
cow(505154) loricrin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000427 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000427 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000427 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU006361 MISSION® esiRNA esiRNA targeting mouse Lor (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000427 Rosetta Predictions human pricing
XM_001057506 Rosetta Predictions rat pricing
XM_580253 Rosetta Predictions rat pricing
NM_008508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160585 predicted 967
2 SASI_Hs01_00160586 predicted 1073
3 SASI_Hs01_00160587 predicted 965
4 SASI_Hs02_00302535 predicted 1151
5 SASI_Hs01_00160588 predicted 1142
6 SASI_Hs01_00160589 predicted 1157
7 SASI_Hs01_00160590 predicted 1041
8 SASI_Hs01_00160591 predicted 919
9 SASI_Hs01_00160592 predicted 1115
10 SASI_Hs01_00160594 predicted 1069
11 SASI_Hs01_00160593 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286626 predicted 1513
2 SASI_Rn02_00286627 predicted 1495
3 SASI_Rn02_00286628 predicted 1498
4 SASI_Rn02_00286629 predicted 1503
5 SASI_Rn02_00286630 predicted 1495
6 SASI_Rn02_00286631 predicted 1708
7 SASI_Rn02_00286632 predicted 1710
8 SASI_Rn02_00286633 predicted 1641
9 SASI_Rn02_00286634 predicted 1543
10 SASI_Rn02_00286635 predicted 1543
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_580253 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00409138 predicted 1512
2 SASI_Rn02_00409139 predicted 1709
3 SASI_Rn02_00409140 predicted 1712
4 SASI_Rn02_00409141 predicted 1636
5 SASI_Rn02_00409142 predicted 1537
6 SASI_Rn02_00409143 predicted 1549
7 SASI_Rn02_00409144 predicted 887
8 SASI_Rn02_00409145 predicted 22
9 SASI_Rn02_00409146 predicted 1705
10 SASI_Rn02_00409147 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314061 predicted 1546
2 SASI_Mm01_00182851 predicted 1535
3 SASI_Mm02_00314062 predicted 1536
4 SASI_Mm01_00182853 predicted 1507
5 SASI_Mm01_00182854 predicted 1506
6 SASI_Mm01_00182855 predicted 1505
7 SASI_Mm01_00182857 predicted 1534
8 SASI_Mm01_00182858 predicted 1510
9 SASI_Mm02_00314063 predicted 1536
10 SASI_Mm01_00182860 predicted 1506
11 SASI_Mm01_00182852 predicted 218
12 SASI_Mm01_00182856 predicted 221
13 SASI_Mm01_00182859 predicted 225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008508
LOR MISSION shRNA Bacterial Glycerol Stock
loricrin
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008508.2-882s21c1
Sequence:CCGGATCGTCCCAACAGTATCAGTGCTCGAGCACTGATACTGTTGGGACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008508.2-108s21c1
Sequence:CCGGTCCTGTGGGTTGTGGAAAGACCTCGAGGTCTTTCCACAACCCACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008508.1-1107s1c1
Sequence:CCGGGCTATTACTCCTCTCAGCAGACTCGAGTCTGCTGAGAGGAGTAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008508.2-1593s21c1
Sequence:CCGGGCTTAACTTTCTCATGAATTTCTCGAGAAATTCATGAGAAAGTTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008508.2-246s21c1
Sequence:CCGGTGGTTCCTATGGAGGTGGTTCCTCGAGGAACCACCTCCATAGGAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008508.2-1514s21c1
Sequence:CCGGCTACCTGGCCGTGCAAGTAAGCTCGAGCTTACTTGCACGGCCAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008508.1-864s1c1
Sequence:CCGGGATCGTCCCAACAGTATCAGTCTCGAGACTGATACTGTTGGGACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008508
LOR MISSION shRNA shRNA Plasmid DNA
loricrin
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008508.2-882s21c1
Sequence:CCGGATCGTCCCAACAGTATCAGTGCTCGAGCACTGATACTGTTGGGACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008508.2-108s21c1
Sequence:CCGGTCCTGTGGGTTGTGGAAAGACCTCGAGGTCTTTCCACAACCCACAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008508.1-1107s1c1
Sequence:CCGGGCTATTACTCCTCTCAGCAGACTCGAGTCTGCTGAGAGGAGTAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008508.2-1593s21c1
Sequence:CCGGGCTTAACTTTCTCATGAATTTCTCGAGAAATTCATGAGAAAGTTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008508.2-246s21c1
Sequence:CCGGTGGTTCCTATGGAGGTGGTTCCTCGAGGAACCACCTCCATAGGAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008508.2-1514s21c1
Sequence:CCGGCTACCTGGCCGTGCAAGTAAGCTCGAGCTTACTTGCACGGCCAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008508.1-864s1c1
Sequence:CCGGGATCGTCCCAACAGTATCAGTCTCGAGACTGATACTGTTGGGACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008508
LOR MISSION shRNA Lentiviral Transduction Particles
loricrin
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008508.2-882s21c1
Sequence:CCGGATCGTCCCAACAGTATCAGTGCTCGAGCACTGATACTGTTGGGACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008508.2-108s21c1
Sequence:CCGGTCCTGTGGGTTGTGGAAAGACCTCGAGGTCTTTCCACAACCCACAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008508.1-1107s1c1
Sequence:CCGGGCTATTACTCCTCTCAGCAGACTCGAGTCTGCTGAGAGGAGTAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008508.2-1593s21c1
Sequence:CCGGGCTTAACTTTCTCATGAATTTCTCGAGAAATTCATGAGAAAGTTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008508.2-246s21c1
Sequence:CCGGTGGTTCCTATGGAGGTGGTTCCTCGAGGAACCACCTCCATAGGAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008508.2-1514s21c1
Sequence:CCGGCTACCTGGCCGTGCAAGTAAGCTCGAGCTTACTTGCACGGCCAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008508.1-864s1c1
Sequence:CCGGGATCGTCCCAACAGTATCAGTCTCGAGACTGATACTGTTGGGACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000427
LOR MISSION shRNA Bacterial Glycerol Stock
loricrin
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000118747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000427.1-1068s1c1
Sequence:CCGGCGAGGTTTGCAAATCCTTCATCTCGAGATGAAGGATTTGCAAACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000427.1-506s1c1
Sequence:CCGGGCCAGAGCTACGGAGGCGTCTCTCGAGAGACGCCTCCGTAGCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000427.1-334s1c1
Sequence:CCGGTCTGGCTGTTTCTCCAGCGGTCTCGAGACCGCTGGAGAAACAGCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000427.1-963s1c1
Sequence:CCGGGCCTACCTGGCCGTCCAAATACTCGAGTATTTGGACGGCCAGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000427
LOR MISSION shRNA shRNA Plasmid DNA
loricrin
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000118747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000427.1-1068s1c1
Sequence:CCGGCGAGGTTTGCAAATCCTTCATCTCGAGATGAAGGATTTGCAAACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000427.1-506s1c1
Sequence:CCGGGCCAGAGCTACGGAGGCGTCTCTCGAGAGACGCCTCCGTAGCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000427.1-334s1c1
Sequence:CCGGTCTGGCTGTTTCTCCAGCGGTCTCGAGACCGCTGGAGAAACAGCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000427.1-963s1c1
Sequence:CCGGGCCTACCTGGCCGTCCAAATACTCGAGTATTTGGACGGCCAGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000427
LOR MISSION shRNA Lentiviral Transduction Particles
loricrin
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000118747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000427.1-1068s1c1
Sequence:CCGGCGAGGTTTGCAAATCCTTCATCTCGAGATGAAGGATTTGCAAACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000427.1-506s1c1
Sequence:CCGGGCCAGAGCTACGGAGGCGTCTCTCGAGAGACGCCTCCGTAGCTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000427.1-334s1c1
Sequence:CCGGTCTGGCTGTTTCTCCAGCGGTCTCGAGACCGCTGGAGAAACAGCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000427.1-963s1c1
Sequence:CCGGGCCTACCTGGCCGTCCAAATACTCGAGTATTTGGACGGCCAGGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)