EMAIL THIS PAGE TO A FRIEND

LOXHD1

lipoxygenase homology domains 1

104 Gene Product Result for
Synonyms: DFNB77 LH2D1
Gene ID:
Human(125336) Summary: This gene encodes a highly conserved protein consisting entirely of PLAT (polycystin/lipoxygenase/alpha-toxin) domains, thought to be involved in targeting proteins to the plasma membrane. Studies in mice show that this gene is expressed in the mechanosensory hair cells in the inner ear, and mutations in this gene lead to auditory defects, indicating that this gene is essential for normal hair cell function. Screening of human families segregating deafness identified a mutation in this gene which causes DFNB77, a progressive form of autosomal-recessive nonsyndromic hearing loss (ARNSHL). Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2010]
Mouse(240411) lipoxygenase homology domains 1
Rat(291427) lipoxygenase homology domains 1
chicken(427648) lipoxygenase homology domains 1
domestic cat(101081578) lipoxygenase homology domains 1
cow(784983) lipoxygenase homology domains 1
cow(531873) lipoxygenase homology domains 1
cow(525035) lipoxygenase homology domains 1
Horse(100068836) lipoxygenase homology domains 1
dog(490467) lipoxygenase homology domains 1
naked mole-rat(101707875) lipoxygenase homology domains 1
domestic guinea pig(100729106) lipoxygenase homology domains 1
sheep(101112528) lipoxygenase homology domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172834 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172834 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172834 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144612 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144612 Rosetta Predictions human pricing
XM_001713754 Rosetta Predictions human pricing
XM_001713755 Rosetta Predictions human pricing
XM_001713756 Rosetta Predictions human pricing
NM_001106132 Rosetta Predictions rat pricing
XM_001472179 Rosetta Predictions mouse pricing
XM_619554 Rosetta Predictions mouse pricing
XM_916184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211249 predicted 1368
2 SASI_Hs01_00211250 predicted 2666
3 SASI_Hs01_00211251 predicted 3231
4 SASI_Hs01_00211252 predicted 3790
5 SASI_Hs01_00211253 predicted 1808
6 SASI_Hs01_00211254 predicted 1756
7 SASI_Hs01_00211255 predicted 3224
8 SASI_Hs01_00211256 predicted 2452
9 SASI_Hs01_00211257 predicted 2971
10 SASI_Hs01_00211258 predicted 3586
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392959 predicted 3839
2 SASI_Hs02_00392960 predicted 3866
3 SASI_Hs02_00392961 predicted 3848
4 SASI_Hs02_00392962 predicted 3944
5 SASI_Hs02_00392963 predicted 3789
6 SASI_Hs02_00392964 predicted 3800
7 SASI_Hs02_00392965 predicted 3366
8 SASI_Hs02_00392966 predicted 3871
9 SASI_Hs02_00392967 predicted 3271
10 SASI_Hs02_00392968 predicted 3268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392969 predicted 4166
2 SASI_Hs02_00392970 predicted 1361
3 SASI_Hs02_00392971 predicted 3226
4 SASI_Hs02_00392972 predicted 3787
5 SASI_Hs02_00392973 predicted 1810
6 SASI_Hs02_00392974 predicted 1745
7 SASI_Hs02_00392975 predicted 2443
8 SASI_Hs02_00392976 predicted 2956
9 SASI_Hs02_00392977 predicted 2887
10 SASI_Hs02_00392978 predicted 4180
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392979 predicted 4171
2 SASI_Hs02_00392980 predicted 1357
3 SASI_Hs02_00392981 predicted 3230
4 SASI_Hs02_00392982 predicted 3791
5 SASI_Hs02_00392983 predicted 1802
6 SASI_Hs02_00392984 predicted 1753
7 SASI_Hs02_00392985 predicted 2439
8 SASI_Hs02_00392986 predicted 2960
9 SASI_Hs02_00392987 predicted 2890
10 SASI_Hs02_00392988 predicted 4176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215938 predicted 2163
2 SASI_Rn02_00215939 predicted 2400
3 SASI_Rn02_00215940 predicted 1723
4 SASI_Rn02_00215941 predicted 2836
5 SASI_Rn02_00215942 predicted 1745
6 SASI_Rn02_00215943 predicted 3453
7 SASI_Rn02_00215944 predicted 1863
8 SASI_Rn02_00215945 predicted 3440
9 SASI_Rn02_00215946 predicted 3212
10 SASI_Rn02_00215947 predicted 3507
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001472179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00359768 predicted 2719
2 SASI_Mm02_00359769 predicted 5982
3 SASI_Mm02_00359770 predicted 1958
4 SASI_Mm02_00359771 predicted 5874
5 SASI_Mm02_00359772 predicted 1442
6 SASI_Mm02_00359773 predicted 2549
7 SASI_Mm02_00359774 predicted 4069
8 SASI_Mm02_00359775 predicted 4205
9 SASI_Mm02_00359776 predicted 3605
10 SASI_Mm02_00359777 predicted 4649
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226530 predicted 2984
2 SASI_Mm01_00226531 predicted 1890
3 SASI_Mm01_00226532 predicted 1360
4 SASI_Mm01_00226533 predicted 3509
5 SASI_Mm01_00226534 predicted 3410
6 SASI_Mm01_00226535 predicted 3028
7 SASI_Mm01_00226536 predicted 3469
8 SASI_Mm01_00226537 predicted 3108
9 SASI_Mm01_00226538 predicted 3102
10 SASI_Mm01_00226539 predicted 1968
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440149 predicted 1207
2 SASI_Mm02_00440150 predicted 528
3 SASI_Mm02_00440151 predicted 6522
4 SASI_Mm02_00440152 predicted 1963
5 SASI_Mm02_00440153 predicted 6407
6 SASI_Mm02_00440154 predicted 1434
7 SASI_Mm02_00440155 predicted 4343
8 SASI_Mm02_00440156 predicted 279
9 SASI_Mm02_00440157 predicted 5824
10 SASI_Mm02_00440158 predicted 1029
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172834
LOXHD1 MISSION shRNA Bacterial Glycerol Stock
lipoxygenase homology domains 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-1444s21c1
Sequence:CCGGGATCTCGGCAGGTTCTATAAGCTCGAGCTTATAGAACCTGCCGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-282s21c1
Sequence:CCGGATTCCGGGTGCGAACCAATAACTCGAGTTATTGGTTCGCACCCGGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172834.2-6388s21c1
Sequence:CCGGTATATTCAGCACATCTCATAACTCGAGTTATGAGATGTGCTGAATATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-3665s21c1
Sequence:CCGGTCCGAGAACTGGTCCCTTATGCTCGAGCATAAGGGACCAGTTCTCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-533s21c1
Sequence:CCGGTGTACACTGGTGACGTGATTGCTCGAGCAATCACGTCACCAGTGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-1803s21c1
Sequence:CCGGAGGCAATGCCGACGAGTTTACCTCGAGGTAAACTCGTCGGCATTGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-1400s21c1
Sequence:CCGGGGTTCAAGCCAGGCATCATTGCTCGAGCAATGATGCCTGGCTTGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172834
LOXHD1 MISSION shRNA shRNA Plasmid DNA
lipoxygenase homology domains 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-1444s21c1
Sequence:CCGGGATCTCGGCAGGTTCTATAAGCTCGAGCTTATAGAACCTGCCGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-282s21c1
Sequence:CCGGATTCCGGGTGCGAACCAATAACTCGAGTTATTGGTTCGCACCCGGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172834.2-6388s21c1
Sequence:CCGGTATATTCAGCACATCTCATAACTCGAGTTATGAGATGTGCTGAATATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-3665s21c1
Sequence:CCGGTCCGAGAACTGGTCCCTTATGCTCGAGCATAAGGGACCAGTTCTCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-533s21c1
Sequence:CCGGTGTACACTGGTGACGTGATTGCTCGAGCAATCACGTCACCAGTGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-1803s21c1
Sequence:CCGGAGGCAATGCCGACGAGTTTACCTCGAGGTAAACTCGTCGGCATTGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-1400s21c1
Sequence:CCGGGGTTCAAGCCAGGCATCATTGCTCGAGCAATGATGCCTGGCTTGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172834
LOXHD1 MISSION shRNA Lentiviral Transduction Particles
lipoxygenase homology domains 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-1444s21c1
Sequence:CCGGGATCTCGGCAGGTTCTATAAGCTCGAGCTTATAGAACCTGCCGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-282s21c1
Sequence:CCGGATTCCGGGTGCGAACCAATAACTCGAGTTATTGGTTCGCACCCGGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172834.2-6388s21c1
Sequence:CCGGTATATTCAGCACATCTCATAACTCGAGTTATGAGATGTGCTGAATATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-3665s21c1
Sequence:CCGGTCCGAGAACTGGTCCCTTATGCTCGAGCATAAGGGACCAGTTCTCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-533s21c1
Sequence:CCGGTGTACACTGGTGACGTGATTGCTCGAGCAATCACGTCACCAGTGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-1803s21c1
Sequence:CCGGAGGCAATGCCGACGAGTTTACCTCGAGGTAAACTCGTCGGCATTGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172834.2-1400s21c1
Sequence:CCGGGGTTCAAGCCAGGCATCATTGCTCGAGCAATGATGCCTGGCTTGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144612
LOXHD1 MISSION shRNA Bacterial Glycerol Stock
lipoxygenase homology domains 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144612.4-3450s1c1
Sequence:CCGGCCATAATAACACGGGCATGAACTCGAGTTCATGCCCGTGTTATTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144612.4-1542s1c1
Sequence:CCGGCCTGAACATTGGAAATATCAACTCGAGTTGATATTTCCAATGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144612.4-721s1c1
Sequence:CCGGCCCGGCATAATCGAGAAGTTTCTCGAGAAACTTCTCGATTATGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144612.4-2951s1c1
Sequence:CCGGCCTCCAAGACAAACAGCGATACTCGAGTATCGCTGTTTGTCTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144612.4-1025s1c1
Sequence:CCGGCCAACGTCTATCTCTGCCTTTCTCGAGAAAGGCAGAGATAGACGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144612.6-498s21c1
Sequence:CCGGGGACATGCCCAGAGGTAATAACTCGAGTTATTACCTCTGGGCATGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144612.6-3341s21c1
Sequence:CCGGACGAGATCACGTACTACTTTCCTCGAGGAAAGTAGTACGTGATCTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144612
LOXHD1 MISSION shRNA shRNA Plasmid DNA
lipoxygenase homology domains 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144612.4-3450s1c1
Sequence:CCGGCCATAATAACACGGGCATGAACTCGAGTTCATGCCCGTGTTATTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144612.4-1542s1c1
Sequence:CCGGCCTGAACATTGGAAATATCAACTCGAGTTGATATTTCCAATGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144612.4-721s1c1
Sequence:CCGGCCCGGCATAATCGAGAAGTTTCTCGAGAAACTTCTCGATTATGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144612.4-2951s1c1
Sequence:CCGGCCTCCAAGACAAACAGCGATACTCGAGTATCGCTGTTTGTCTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144612.4-1025s1c1
Sequence:CCGGCCAACGTCTATCTCTGCCTTTCTCGAGAAAGGCAGAGATAGACGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144612.6-498s21c1
Sequence:CCGGGGACATGCCCAGAGGTAATAACTCGAGTTATTACCTCTGGGCATGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144612.6-3341s21c1
Sequence:CCGGACGAGATCACGTACTACTTTCCTCGAGGAAAGTAGTACGTGATCTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144612
LOXHD1 MISSION shRNA Lentiviral Transduction Particles
lipoxygenase homology domains 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144612.4-3450s1c1
Sequence:CCGGCCATAATAACACGGGCATGAACTCGAGTTCATGCCCGTGTTATTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144612.4-1542s1c1
Sequence:CCGGCCTGAACATTGGAAATATCAACTCGAGTTGATATTTCCAATGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144612.4-721s1c1
Sequence:CCGGCCCGGCATAATCGAGAAGTTTCTCGAGAAACTTCTCGATTATGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144612.4-2951s1c1
Sequence:CCGGCCTCCAAGACAAACAGCGATACTCGAGTATCGCTGTTTGTCTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144612.4-1025s1c1
Sequence:CCGGCCAACGTCTATCTCTGCCTTTCTCGAGAAAGGCAGAGATAGACGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144612.6-498s21c1
Sequence:CCGGGGACATGCCCAGAGGTAATAACTCGAGTTATTACCTCTGGGCATGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144612.6-3341s21c1
Sequence:CCGGACGAGATCACGTACTACTTTCCTCGAGGAAAGTAGTACGTGATCTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)