EMAIL THIS PAGE TO A FRIEND

LOXL1

lysyl oxidase-like 1

107 Gene Product Result for
Synonyms: LOL LOXL
UniProtKB ID: Q08397, Q6NUL3, Q96BW7
Gene ID:
Human(4016) Summary: This gene encodes a member of the lysyl oxidase gene family. The prototypic member of the family is essential to the biogenesis of connective tissue, encoding an extracellular copper-dependent amine oxidase that catalyses the first step in the formation of crosslinks in collagens and elastin. A highly conserved amino acid sequence at the C-terminus end appears to be sufficient for amine oxidase activity, suggesting that each family member may retain this function. The N-terminus is poorly conserved and may impart additional roles in developmental regulation, senescence, tumor suppression, cell growth control, and chemotaxis to each member of the family. [provided by RefSeq, Jul 2008]
Mouse(16949) lysyl oxidase-like 1
Rat(315714) lysyl oxidase-like 1
Zebrafish(560115) lysyl oxidase-like 1
dog(100686150) lysyl oxidase-like 1
Horse(100051862) lysyl oxidase-like 1
cow(281903) lysyl oxidase-like 1
domestic cat(101089616) lysyl oxidase-like 1
chicken(426411) lysyl oxidase-like 1
sheep(101112424) lysyl oxidase-like 1
domestic guinea pig(100720568) lysyl oxidase-like 1
naked mole-rat(101710365) lysyl oxidase-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005576 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005576 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005576 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005576 Rosetta Predictions human pricing
NM_001012125 Rosetta Predictions rat pricing
XM_576419 Rosetta Predictions rat pricing
NM_010729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339857 predicted 476
2 SASI_Hs01_00214871 predicted 1861
3 SASI_Hs01_00214872 predicted 692
4 SASI_Hs01_00214873 predicted 1805
5 SASI_Hs02_00339858 predicted 1940
6 SASI_Hs01_00214875 predicted 1501
7 SASI_Hs01_00214876 predicted 1712
8 SASI_Hs01_00214877 predicted 1917
9 SASI_Hs01_00214878 predicted 1968
10 SASI_Hs01_00214879 predicted 498
11 SASI_Hs01_00214870 predicted 1943
12 SASI_Hs01_00214874 predicted 1852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077675 predicted 1893
2 SASI_Rn01_00077676 predicted 1575
3 SASI_Rn01_00077677 predicted 1945
4 SASI_Rn01_00077678 predicted 632
5 SASI_Rn01_00077679 predicted 1635
6 SASI_Rn01_00077680 predicted 1176
7 SASI_Rn01_00077681 predicted 2105
8 SASI_Rn01_00077682 predicted 1641
9 SASI_Rn01_00077683 predicted 1389
10 SASI_Rn01_00077684 predicted 1789
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160961 predicted 1575
2 SASI_Rn01_00160962 predicted 1399
3 SASI_Rn01_00160963 predicted 1795
4 SASI_Rn01_00160964 predicted 1651
5 SASI_Rn01_00160965 predicted 1471
6 SASI_Rn01_00160966 predicted 1495
7 SASI_Rn01_00160967 predicted 1487
8 SASI_Rn01_00160968 predicted 1180
9 SASI_Rn01_00160969 predicted 519
10 SASI_Rn01_00160970 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156336 predicted 2085
2 SASI_Mm01_00156337 predicted 1934
3 SASI_Mm01_00156338 predicted 455
4 SASI_Mm01_00156339 predicted 1921
5 SASI_Mm01_00156340 predicted 628
6 SASI_Mm01_00156341 predicted 1546
7 SASI_Mm01_00156342 predicted 2028
8 SASI_Mm01_00156343 predicted 1881
9 SASI_Mm01_00156344 predicted 1516
10 SASI_Mm01_00156345 predicted 2123
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010729
VALIDATED
LOXL1 MISSION shRNA Bacterial Glycerol Stock
lysyl oxidase-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010729.3-1975s21c1
Sequence:CCGGACTGCCAGTGGATCGACATAACTCGAGTTATGTCGATCCACTGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010729.3-1953s21c1
Sequence:CCGGGACACATACAATGCGGACATTCTCGAGAATGTCCGCATTGTATGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010729.3-881s21c1
Sequence:CCGGCGTAAACCAGTATGAGAACTACTCGAGTAGTTCTCATACTGGTTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010729.3-1664s21c1
Sequence:CCGGCTATGACCTCCGAGTGCTATTCTCGAGAATAGCACTCGGAGGTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010729.2-865s1c1
Sequence:CCGGCGTAAACCAGTATGAGAACTACTCGAGTAGTTCTCATACTGGTTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010729.2-862s1c1
Sequence:CCGGCTTCGTAAACCAGTATGAGAACTCGAGTTCTCATACTGGTTTACGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010729.2-1937s1c1
Sequence:CCGGGACACATACAATGCGGACATTCTCGAGAATGTCCGCATTGTATGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010729.3-2370s21c1
Sequence:CCGGGTCTGTTGTTGGTTCTAATTTCTCGAGAAATTAGAACCAACAACAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010729.2-2098s1c1
Sequence:CCGGCGTTTCTACAACAAACTGCAACTCGAGTTGCAGTTTGTTGTAGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010729.2-2092s1c1
Sequence:CCGGTCGCTACGTTTCTACAACAAACTCGAGTTTGTTGTAGAAACGTAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010729
VALIDATED
LOXL1 MISSION shRNA shRNA Plasmid DNA
lysyl oxidase-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010729.3-1975s21c1
Sequence:CCGGACTGCCAGTGGATCGACATAACTCGAGTTATGTCGATCCACTGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010729.3-1953s21c1
Sequence:CCGGGACACATACAATGCGGACATTCTCGAGAATGTCCGCATTGTATGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010729.3-881s21c1
Sequence:CCGGCGTAAACCAGTATGAGAACTACTCGAGTAGTTCTCATACTGGTTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010729.3-1664s21c1
Sequence:CCGGCTATGACCTCCGAGTGCTATTCTCGAGAATAGCACTCGGAGGTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010729.2-865s1c1
Sequence:CCGGCGTAAACCAGTATGAGAACTACTCGAGTAGTTCTCATACTGGTTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010729.2-862s1c1
Sequence:CCGGCTTCGTAAACCAGTATGAGAACTCGAGTTCTCATACTGGTTTACGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010729.2-1937s1c1
Sequence:CCGGGACACATACAATGCGGACATTCTCGAGAATGTCCGCATTGTATGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010729.3-2370s21c1
Sequence:CCGGGTCTGTTGTTGGTTCTAATTTCTCGAGAAATTAGAACCAACAACAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010729.2-2098s1c1
Sequence:CCGGCGTTTCTACAACAAACTGCAACTCGAGTTGCAGTTTGTTGTAGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010729.2-2092s1c1
Sequence:CCGGTCGCTACGTTTCTACAACAAACTCGAGTTTGTTGTAGAAACGTAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010729
VALIDATED
LOXL1 MISSION shRNA Lentiviral Transduction Particles
lysyl oxidase-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010729.3-1975s21c1
Sequence:CCGGACTGCCAGTGGATCGACATAACTCGAGTTATGTCGATCCACTGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010729.3-1953s21c1
Sequence:CCGGGACACATACAATGCGGACATTCTCGAGAATGTCCGCATTGTATGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010729.3-881s21c1
Sequence:CCGGCGTAAACCAGTATGAGAACTACTCGAGTAGTTCTCATACTGGTTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010729.3-1664s21c1
Sequence:CCGGCTATGACCTCCGAGTGCTATTCTCGAGAATAGCACTCGGAGGTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010729.2-865s1c1
Sequence:CCGGCGTAAACCAGTATGAGAACTACTCGAGTAGTTCTCATACTGGTTTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010729.2-862s1c1
Sequence:CCGGCTTCGTAAACCAGTATGAGAACTCGAGTTCTCATACTGGTTTACGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010729.2-1937s1c1
Sequence:CCGGGACACATACAATGCGGACATTCTCGAGAATGTCCGCATTGTATGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010729.3-2370s21c1
Sequence:CCGGGTCTGTTGTTGGTTCTAATTTCTCGAGAAATTAGAACCAACAACAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010729.2-2098s1c1
Sequence:CCGGCGTTTCTACAACAAACTGCAACTCGAGTTGCAGTTTGTTGTAGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010729.2-2092s1c1
Sequence:CCGGTCGCTACGTTTCTACAACAAACTCGAGTTTGTTGTAGAAACGTAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005576
VALIDATED
LOXL1 MISSION shRNA Bacterial Glycerol Stock
lysyl oxidase-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005576.2-2189s21c1
Sequence:CCGGAGGGAGCGAACGTGGATGAAACTCGAGTTTCATCCACGTTCGCTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005576.2-1988s21c1
Sequence:CCGGACGTGGTGAGATGCAACATTCCTCGAGGAATGTTGCATCTCACCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005576.1-1435s1c1
Sequence:CCGGACTATGTGCAAGCATCCACTTCTCGAGAAGTGGATGCTTGCACATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005576.2-2020s21c1
Sequence:CCGGCGCTACGTTTCTGCAACAAACCTCGAGGTTTGTTGCAGAAACGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005576.1-1910s1c1
Sequence:CCGGGCACGTGAACCCAAAGTATATCTCGAGATATACTTTGGGTTCACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005576.2-1886s21c1
Sequence:CCGGACTGCCAGTGGATCGACATAACTCGAGTTATGTCGATCCACTGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005576.2-1942s21c1
Sequence:GTACCGGCACGTGAACCCAAAGTATATTCTCGAGAATATACTTTGGGTTCACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005576.1-1973s1c1
Sequence:CCGGCATTCACTACACAGGTCGCTACTCGAGTAGCGACCTGTGTAGTGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005576.1-452s1c1
Sequence:CCGGGCAGGTGTACAGCTTGCTCAACTCGAGTTGAGCAAGCTGTACACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005576.1-890s1c1
Sequence:CCGGGCGGACCTACGACCAGGGTTTCTCGAGAAACCCTGGTCGTAGGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005576
VALIDATED
LOXL1 MISSION shRNA shRNA Plasmid DNA
lysyl oxidase-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005576.2-2189s21c1
Sequence:CCGGAGGGAGCGAACGTGGATGAAACTCGAGTTTCATCCACGTTCGCTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005576.2-1988s21c1
Sequence:CCGGACGTGGTGAGATGCAACATTCCTCGAGGAATGTTGCATCTCACCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005576.1-1435s1c1
Sequence:CCGGACTATGTGCAAGCATCCACTTCTCGAGAAGTGGATGCTTGCACATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005576.2-2020s21c1
Sequence:CCGGCGCTACGTTTCTGCAACAAACCTCGAGGTTTGTTGCAGAAACGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005576.1-1910s1c1
Sequence:CCGGGCACGTGAACCCAAAGTATATCTCGAGATATACTTTGGGTTCACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005576.2-1886s21c1
Sequence:CCGGACTGCCAGTGGATCGACATAACTCGAGTTATGTCGATCCACTGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005576.2-1942s21c1
Sequence:GTACCGGCACGTGAACCCAAAGTATATTCTCGAGAATATACTTTGGGTTCACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005576.1-1973s1c1
Sequence:CCGGCATTCACTACACAGGTCGCTACTCGAGTAGCGACCTGTGTAGTGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005576.1-452s1c1
Sequence:CCGGGCAGGTGTACAGCTTGCTCAACTCGAGTTGAGCAAGCTGTACACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005576.1-890s1c1
Sequence:CCGGGCGGACCTACGACCAGGGTTTCTCGAGAAACCCTGGTCGTAGGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005576
VALIDATED
LOXL1 MISSION shRNA Lentiviral Transduction Particles
lysyl oxidase-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005576.2-2189s21c1
Sequence:CCGGAGGGAGCGAACGTGGATGAAACTCGAGTTTCATCCACGTTCGCTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005576.2-1988s21c1
Sequence:CCGGACGTGGTGAGATGCAACATTCCTCGAGGAATGTTGCATCTCACCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005576.1-1435s1c1
Sequence:CCGGACTATGTGCAAGCATCCACTTCTCGAGAAGTGGATGCTTGCACATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005576.2-2020s21c1
Sequence:CCGGCGCTACGTTTCTGCAACAAACCTCGAGGTTTGTTGCAGAAACGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005576.1-1910s1c1
Sequence:CCGGGCACGTGAACCCAAAGTATATCTCGAGATATACTTTGGGTTCACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005576.2-1886s21c1
Sequence:CCGGACTGCCAGTGGATCGACATAACTCGAGTTATGTCGATCCACTGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005576.2-1942s21c1
Sequence:GTACCGGCACGTGAACCCAAAGTATATTCTCGAGAATATACTTTGGGTTCACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005576.1-1973s1c1
Sequence:CCGGCATTCACTACACAGGTCGCTACTCGAGTAGCGACCTGTGTAGTGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005576.1-452s1c1
Sequence:CCGGGCAGGTGTACAGCTTGCTCAACTCGAGTTGAGCAAGCTGTACACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005576.1-890s1c1
Sequence:CCGGGCGGACCTACGACCAGGGTTTCTCGAGAAACCCTGGTCGTAGGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)