EMAIL THIS PAGE TO A FRIEND

LOXL3

lysyl oxidase-like 3

115 Gene Product Result for
Synonyms: LOXL
UniProtKB ID: P58215, D6W5J1, Q96RS1
Gene ID:
Human(84695) Summary: This gene encodes a member of the lysyl oxidase gene family. The prototypic member of the family is essential to the biogenesis of connective tissue, encoding an extracellular copper-dependent amine oxidase that catalyses the first step in the formation of crosslinks in collagens and elastin. A highly conserved amino acid sequence at the C-terminus end appears to be sufficient for amine oxidase activity, suggesting that each family member may retain this function. The N-terminus is poorly conserved and may impart additional roles in developmental regulation, senescence, tumor suppression, cell growth control, and chemotaxis to each member of the family. Alternatively spliced transcript variants of this gene have been reported but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(16950) lysyl oxidase-like 3
Rat(312478) lysyl oxidase-like 3
Zebrafish(553538) LOXL3 protein
domestic cat(101087470) lysyl oxidase-like 3
cow(613599) lysyl oxidase-like 3
Horse(100053584) lysyl oxidase-like 3
dog(483101) lysyl oxidase-like 3
chicken(425986) lysyl oxidase-like 3
sheep(101119969) lysyl oxidase-like 3
domestic guinea pig(100733784) lysyl oxidase-like 3
naked mole-rat(101726484) lysyl oxidase-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013586 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013586 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013586 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032603 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052161 MISSION® esiRNA esiRNA human LOXL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032603 Rosetta Predictions human pricing
NM_001107866 Rosetta Predictions rat pricing
NM_013586 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100691 predicted 2023
2 SASI_Hs01_00100692 predicted 1716
3 SASI_Hs01_00100693 predicted 2222
4 SASI_Hs01_00100694 predicted 2209
5 SASI_Hs01_00100695 predicted 2253
6 SASI_Hs01_00100696 predicted 2428
7 SASI_Hs01_00100697 predicted 2190
8 SASI_Hs01_00100698 predicted 1162
9 SASI_Hs01_00100700 predicted 1967
10 SASI_Hs02_00360153 predicted 2388
11 SASI_Hs01_00100699 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233055 predicted 2381
2 SASI_Rn02_00233056 predicted 2245
3 SASI_Rn02_00233057 predicted 2466
4 SASI_Rn02_00233058 predicted 2195
5 SASI_Rn02_00233059 predicted 2249
6 SASI_Rn02_00233060 predicted 2218
7 SASI_Rn02_00233061 predicted 2319
8 SASI_Rn02_00233062 predicted 2036
9 SASI_Rn02_00233063 predicted 977
10 SASI_Rn02_00233064 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084345 predicted 2411
2 SASI_Mm01_00084346 predicted 2223
3 SASI_Mm01_00084347 predicted 2172
4 SASI_Mm01_00084348 predicted 1851
5 SASI_Mm01_00084349 predicted 1919
6 SASI_Mm01_00084350 predicted 2046
7 SASI_Mm01_00084351 predicted 2193
8 SASI_Mm01_00084352 predicted 1994
9 SASI_Mm01_00084353 predicted 943
10 SASI_Mm01_00084354 predicted 2140
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013586
VALIDATED
LOXL3 MISSION shRNA Bacterial Glycerol Stock
lysyl oxidase-like 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013586.4-2048s21c1
Sequence:CCGGGGTATGAGTGCGCCAACTTTGCTCGAGCAAAGTTGGCGCACTCATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013586.4-2339s21c1
Sequence:CCGGCTAGTAACCAGATCGTCTAAACTCGAGTTTAGACGATCTGGTTACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013586.4-2172s21c1
Sequence:CCGGGGTCGTTATCAACCCAAATTTCTCGAGAAATTTGGGTTGATAACGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013586.4-2704s21c1
Sequence:CCGGCCGCGTTACCTCTAGCCATTTCTCGAGAAATGGCTAGAGGTAACGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013586.4-1987s21c1
Sequence:CCGGGAGGGCCACAAAGCTAGTTTCCTCGAGGAAACTAGCTTTGTGGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013586.2-3242s1c1
Sequence:CCGGGCCCAGGATAACTTTATGAATCTCGAGATTCATAAAGTTATCCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013586.2-875s1c1
Sequence:CCGGCTAGAGTTCTATCGTGCCAATCTCGAGATTGGCACGATAGAACTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013586.2-948s1c1
Sequence:CCGGGCCCTCTTTATGCCACCTTTACTCGAGTAAAGGTGGCATAAAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013586.2-2218s1c1
Sequence:CCGGCAACAATGCAATGAAGTGTAACTCGAGTTACACTTCATTGCATTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013586.2-2171s1c1
Sequence:CCGGCAGGTCGTTATCAACCCAAATCTCGAGATTTGGGTTGATAACGACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013586
VALIDATED
LOXL3 MISSION shRNA shRNA Plasmid DNA
lysyl oxidase-like 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013586.4-2048s21c1
Sequence:CCGGGGTATGAGTGCGCCAACTTTGCTCGAGCAAAGTTGGCGCACTCATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013586.4-2339s21c1
Sequence:CCGGCTAGTAACCAGATCGTCTAAACTCGAGTTTAGACGATCTGGTTACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013586.4-2172s21c1
Sequence:CCGGGGTCGTTATCAACCCAAATTTCTCGAGAAATTTGGGTTGATAACGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013586.4-2704s21c1
Sequence:CCGGCCGCGTTACCTCTAGCCATTTCTCGAGAAATGGCTAGAGGTAACGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013586.4-1987s21c1
Sequence:CCGGGAGGGCCACAAAGCTAGTTTCCTCGAGGAAACTAGCTTTGTGGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013586.2-3242s1c1
Sequence:CCGGGCCCAGGATAACTTTATGAATCTCGAGATTCATAAAGTTATCCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013586.2-875s1c1
Sequence:CCGGCTAGAGTTCTATCGTGCCAATCTCGAGATTGGCACGATAGAACTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013586.2-948s1c1
Sequence:CCGGGCCCTCTTTATGCCACCTTTACTCGAGTAAAGGTGGCATAAAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013586.2-2218s1c1
Sequence:CCGGCAACAATGCAATGAAGTGTAACTCGAGTTACACTTCATTGCATTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013586.2-2171s1c1
Sequence:CCGGCAGGTCGTTATCAACCCAAATCTCGAGATTTGGGTTGATAACGACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013586
VALIDATED
LOXL3 MISSION shRNA Lentiviral Transduction Particles
lysyl oxidase-like 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013586.4-2048s21c1
Sequence:CCGGGGTATGAGTGCGCCAACTTTGCTCGAGCAAAGTTGGCGCACTCATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013586.4-2339s21c1
Sequence:CCGGCTAGTAACCAGATCGTCTAAACTCGAGTTTAGACGATCTGGTTACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013586.4-2172s21c1
Sequence:CCGGGGTCGTTATCAACCCAAATTTCTCGAGAAATTTGGGTTGATAACGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013586.4-2704s21c1
Sequence:CCGGCCGCGTTACCTCTAGCCATTTCTCGAGAAATGGCTAGAGGTAACGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013586.4-1987s21c1
Sequence:CCGGGAGGGCCACAAAGCTAGTTTCCTCGAGGAAACTAGCTTTGTGGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013586.2-3242s1c1
Sequence:CCGGGCCCAGGATAACTTTATGAATCTCGAGATTCATAAAGTTATCCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013586.2-875s1c1
Sequence:CCGGCTAGAGTTCTATCGTGCCAATCTCGAGATTGGCACGATAGAACTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013586.2-948s1c1
Sequence:CCGGGCCCTCTTTATGCCACCTTTACTCGAGTAAAGGTGGCATAAAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013586.2-2218s1c1
Sequence:CCGGCAACAATGCAATGAAGTGTAACTCGAGTTACACTTCATTGCATTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013586.2-2171s1c1
Sequence:CCGGCAGGTCGTTATCAACCCAAATCTCGAGATTTGGGTTGATAACGACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032603
VALIDATED
LOXL3 MISSION shRNA Bacterial Glycerol Stock
lysyl oxidase-like 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032603.2-2023s21c1
Sequence:CCGGCGGTATGAGTGTGCCAACTTTCTCGAGAAAGTTGGCACACTCATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032603.2-2189s21c1
Sequence:CCGGTTACCAACAATGCAATGAAATCTCGAGATTTCATTGCATTGTTGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032603.2-1914s21c1
Sequence:CCGGCATCTTCACTCACTATGATATCTCGAGATATCATAGTGAGTGAAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032603.2-1499s21c1
Sequence:CCGGACTGGGACTCTGGGAATATAACTCGAGTTATATTCCCAGAGTCCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032603.2-353s21c1
Sequence:CCGGGGACCCACAGTGCCAAATATGCTCGAGCATATTTGGCACTGTGGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032603.2-2145s1c1
Sequence:CCGGCCAGGTTGTCATCAACCCAAACTCGAGTTTGGGTTGATGACAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032603.2-2310s1c1
Sequence:CCGGCCAGACCAGCAACCAGATTATCTCGAGATAATCTGGTTGCTGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032603.2-422s1c1
Sequence:CCGGCCGAGCAGAGTGTGACTGAATCTCGAGATTCAGTCACACTCTGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032603.2-2023s1c1
Sequence:CCGGCGGTATGAGTGTGCCAACTTTCTCGAGAAAGTTGGCACACTCATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032603.2-850s1c1
Sequence:CCGGCTGGAGTTCTATCGTGCCAATCTCGAGATTGGCACGATAGAACTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032603
VALIDATED
LOXL3 MISSION shRNA shRNA Plasmid DNA
lysyl oxidase-like 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032603.2-2023s21c1
Sequence:CCGGCGGTATGAGTGTGCCAACTTTCTCGAGAAAGTTGGCACACTCATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032603.2-2189s21c1
Sequence:CCGGTTACCAACAATGCAATGAAATCTCGAGATTTCATTGCATTGTTGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032603.2-1914s21c1
Sequence:CCGGCATCTTCACTCACTATGATATCTCGAGATATCATAGTGAGTGAAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032603.2-1499s21c1
Sequence:CCGGACTGGGACTCTGGGAATATAACTCGAGTTATATTCCCAGAGTCCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032603.2-353s21c1
Sequence:CCGGGGACCCACAGTGCCAAATATGCTCGAGCATATTTGGCACTGTGGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032603.2-2145s1c1
Sequence:CCGGCCAGGTTGTCATCAACCCAAACTCGAGTTTGGGTTGATGACAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032603.2-2310s1c1
Sequence:CCGGCCAGACCAGCAACCAGATTATCTCGAGATAATCTGGTTGCTGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032603.2-422s1c1
Sequence:CCGGCCGAGCAGAGTGTGACTGAATCTCGAGATTCAGTCACACTCTGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032603.2-2023s1c1
Sequence:CCGGCGGTATGAGTGTGCCAACTTTCTCGAGAAAGTTGGCACACTCATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032603.2-850s1c1
Sequence:CCGGCTGGAGTTCTATCGTGCCAATCTCGAGATTGGCACGATAGAACTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032603
VALIDATED
LOXL3 MISSION shRNA Lentiviral Transduction Particles
lysyl oxidase-like 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032603.2-2023s21c1
Sequence:CCGGCGGTATGAGTGTGCCAACTTTCTCGAGAAAGTTGGCACACTCATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032603.2-2189s21c1
Sequence:CCGGTTACCAACAATGCAATGAAATCTCGAGATTTCATTGCATTGTTGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032603.2-1914s21c1
Sequence:CCGGCATCTTCACTCACTATGATATCTCGAGATATCATAGTGAGTGAAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032603.2-1499s21c1
Sequence:CCGGACTGGGACTCTGGGAATATAACTCGAGTTATATTCCCAGAGTCCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032603.2-353s21c1
Sequence:CCGGGGACCCACAGTGCCAAATATGCTCGAGCATATTTGGCACTGTGGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032603.2-2145s1c1
Sequence:CCGGCCAGGTTGTCATCAACCCAAACTCGAGTTTGGGTTGATGACAACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032603.2-2310s1c1
Sequence:CCGGCCAGACCAGCAACCAGATTATCTCGAGATAATCTGGTTGCTGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032603.2-422s1c1
Sequence:CCGGCCGAGCAGAGTGTGACTGAATCTCGAGATTCAGTCACACTCTGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032603.2-2023s1c1
Sequence:CCGGCGGTATGAGTGTGCCAACTTTCTCGAGAAAGTTGGCACACTCATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032603.2-850s1c1
Sequence:CCGGCTGGAGTTCTATCGTGCCAATCTCGAGATTGGCACGATAGAACTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)