EMAIL THIS PAGE TO A FRIEND

LOXL4

lysyl oxidase-like 4

122 Gene Product Result for
Synonyms: LOXC
UniProtKB ID: Q96JB6, Q5W0B3, Q96DY1, Q96PC0, Q9H6T5
Gene ID:
Human(84171) Summary: This gene encodes a member of the lysyl oxidase gene family. The prototypic member of the family is essential to the biogenesis of connective tissue, encoding an extracellular copper-dependent amine oxidase that catalyses the first step in the formation of crosslinks in collagens and elastin. A highly conserved amino acid sequence at the C-terminus end appears to be sufficient for amine oxidase activity, suggesting that each family member may retain this function. The N-terminus is poorly conserved and may impart additional roles in developmental regulation, senescence, tumor suppression, cell growth control, and chemotaxis to each member of the family. [provided by RefSeq, Jul 2008]
Mouse(67573) lysyl oxidase-like 4
Rat(309380) lysyl oxidase-like 4
Zebrafish(100320658) lysyl oxidase-like 4
cow(281904) lysyl oxidase-like 4
Horse(100070637) lysyl oxidase-like 4
domestic cat(101083112) lysyl oxidase-like 4
dog(486830) lysyl oxidase-like 4
chicken(769927) lysyl oxidase-like 4
naked mole-rat(101707770) lysyl oxidase-like 4
Domestic Rabbit(100357674) lysyl oxidase-like 4
domestic guinea pig(100722686) lysyl oxidase-like 4
sheep(101117380) lysyl oxidase-like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032211 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032211 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032211 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053083 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053083 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053083 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032211 Rosetta Predictions human pricing
NM_001107592 Rosetta Predictions rat pricing
NM_053083 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110220 predicted 2454
2 SASI_Hs01_00110221 predicted 1990
3 SASI_Hs01_00110222 predicted 1386
4 SASI_Hs01_00110223 predicted 2214
5 SASI_Hs01_00110224 predicted 1379
6 SASI_Hs01_00110225 predicted 2268
7 SASI_Hs01_00110226 predicted 1019
8 SASI_Hs01_00110228 predicted 315
9 SASI_Hs01_00110229 predicted 2410
10 SASI_Hs02_00359508 predicted 817
11 SASI_Hs01_00110227 predicted 2272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230355 predicted 430
2 SASI_Rn02_00230356 predicted 1299
3 SASI_Rn02_00230357 predicted 743
4 SASI_Rn02_00230358 predicted 1517
5 SASI_Rn02_00230359 predicted 2220
6 SASI_Rn02_00230360 predicted 1741
7 SASI_Rn02_00230361 predicted 274
8 SASI_Rn02_00230362 predicted 2154
9 SASI_Rn02_00230363 predicted 789
10 SASI_Rn02_00230364 predicted 1524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053083 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196107 predicted 2171
2 SASI_Mm01_00196108 predicted 217
3 SASI_Mm01_00196109 predicted 1235
4 SASI_Mm01_00196110 predicted 1467
5 SASI_Mm01_00196111 predicted 344
6 SASI_Mm01_00196112 predicted 401
7 SASI_Mm01_00196113 predicted 1680
8 SASI_Mm01_00196114 predicted 1438
9 SASI_Mm01_00196115 predicted 690
10 SASI_Mm01_00196116 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032211
VALIDATED
LOXL4 MISSION shRNA Bacterial Glycerol Stock
lysyl oxidase-like 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032211.5-862s1c1
Sequence:CCGGCCTGACGAATAAGAACTCCTTCTCGAGAAGGAGTTCTTATTCGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032211.5-2224s1c1
Sequence:CCGGGAATTATATCTTCCAGGTGATCTCGAGATCACCTGGAAGATATAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032211.5-1387s1c1
Sequence:CCGGCCCTAACATGGGCTTTCAGAACTCGAGTTCTGAAAGCCCATGTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032211.5-811s1c1
Sequence:CCGGCAGGAAAGTCTGGGATCTGAACTCGAGTTCAGATCCCAGACTTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032211.5-2269s1c1
Sequence:CCGGAGAGTCAGATTTCTCCAACAACTCGAGTTGTTGGAGAAATCTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032211.6-2572s21c1
Sequence:CCGGTCACCAATCCAGATGGTATTGCTCGAGCAATACCATCTGGATTGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032211.6-476s21c1
Sequence:CCGGTTGGACCAGTGCGGGTCTAATCTCGAGATTAGACCCGCACTGGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032211.6-2269s21c1
Sequence:CCGGAGAGTCAGATTTCTCCAACAACTCGAGTTGTTGGAGAAATCTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032211.6-1387s21c1
Sequence:CCGGCCCTAACATGGGCTTTCAGAACTCGAGTTCTGAAAGCCCATGTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032211.6-811s21c1
Sequence:CCGGCAGGAAAGTCTGGGATCTGAACTCGAGTTCAGATCCCAGACTTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032211
VALIDATED
LOXL4 MISSION shRNA shRNA Plasmid DNA
lysyl oxidase-like 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032211.5-862s1c1
Sequence:CCGGCCTGACGAATAAGAACTCCTTCTCGAGAAGGAGTTCTTATTCGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032211.5-2224s1c1
Sequence:CCGGGAATTATATCTTCCAGGTGATCTCGAGATCACCTGGAAGATATAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032211.5-1387s1c1
Sequence:CCGGCCCTAACATGGGCTTTCAGAACTCGAGTTCTGAAAGCCCATGTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032211.5-811s1c1
Sequence:CCGGCAGGAAAGTCTGGGATCTGAACTCGAGTTCAGATCCCAGACTTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032211.5-2269s1c1
Sequence:CCGGAGAGTCAGATTTCTCCAACAACTCGAGTTGTTGGAGAAATCTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032211.6-2572s21c1
Sequence:CCGGTCACCAATCCAGATGGTATTGCTCGAGCAATACCATCTGGATTGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032211.6-476s21c1
Sequence:CCGGTTGGACCAGTGCGGGTCTAATCTCGAGATTAGACCCGCACTGGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032211.6-2269s21c1
Sequence:CCGGAGAGTCAGATTTCTCCAACAACTCGAGTTGTTGGAGAAATCTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032211.6-1387s21c1
Sequence:CCGGCCCTAACATGGGCTTTCAGAACTCGAGTTCTGAAAGCCCATGTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032211.6-811s21c1
Sequence:CCGGCAGGAAAGTCTGGGATCTGAACTCGAGTTCAGATCCCAGACTTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032211
VALIDATED
LOXL4 MISSION shRNA Lentiviral Transduction Particles
lysyl oxidase-like 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032211.5-862s1c1
Sequence:CCGGCCTGACGAATAAGAACTCCTTCTCGAGAAGGAGTTCTTATTCGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032211.5-2224s1c1
Sequence:CCGGGAATTATATCTTCCAGGTGATCTCGAGATCACCTGGAAGATATAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_032211.5-1387s1c1
Sequence:CCGGCCCTAACATGGGCTTTCAGAACTCGAGTTCTGAAAGCCCATGTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032211.5-811s1c1
Sequence:CCGGCAGGAAAGTCTGGGATCTGAACTCGAGTTCAGATCCCAGACTTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032211.5-2269s1c1
Sequence:CCGGAGAGTCAGATTTCTCCAACAACTCGAGTTGTTGGAGAAATCTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032211.6-2572s21c1
Sequence:CCGGTCACCAATCCAGATGGTATTGCTCGAGCAATACCATCTGGATTGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032211.6-476s21c1
Sequence:CCGGTTGGACCAGTGCGGGTCTAATCTCGAGATTAGACCCGCACTGGTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032211.6-2269s21c1
Sequence:CCGGAGAGTCAGATTTCTCCAACAACTCGAGTTGTTGGAGAAATCTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032211.6-1387s21c1
Sequence:CCGGCCCTAACATGGGCTTTCAGAACTCGAGTTCTGAAAGCCCATGTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032211.6-811s21c1
Sequence:CCGGCAGGAAAGTCTGGGATCTGAACTCGAGTTCAGATCCCAGACTTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053083
LOXL4 MISSION shRNA Bacterial Glycerol Stock
lysyl oxidase-like 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053083.1-167s1c1
Sequence:CCGGGCACGGTGTGTGATGATGATTCTCGAGAATCATCATCACACACCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053083.1-1922s1c1
Sequence:CCGGGCTTCTGTCTAGAAGATACAACTCGAGTTGTATCTTCTAGACAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053083.1-327s1c1
Sequence:CCGGCCTAGATCAGTGTGGCTCTAACTCGAGTTAGAGCCACACTGATCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053083.1-291s1c1
Sequence:CCGGGCTGGACAATGTTCGTTGTTTCTCGAGAAACAACGAACATTGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053083.1-1468s1c2
Sequence:CCGGGAAGTGGTGATGAGTGGAGTTCTCGAGAACTCCACTCATCACCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053083
LOXL4 MISSION shRNA shRNA Plasmid DNA
lysyl oxidase-like 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053083.1-167s1c1
Sequence:CCGGGCACGGTGTGTGATGATGATTCTCGAGAATCATCATCACACACCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053083.1-1922s1c1
Sequence:CCGGGCTTCTGTCTAGAAGATACAACTCGAGTTGTATCTTCTAGACAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053083.1-327s1c1
Sequence:CCGGCCTAGATCAGTGTGGCTCTAACTCGAGTTAGAGCCACACTGATCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053083.1-291s1c1
Sequence:CCGGGCTGGACAATGTTCGTTGTTTCTCGAGAAACAACGAACATTGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053083.1-1468s1c2
Sequence:CCGGGAAGTGGTGATGAGTGGAGTTCTCGAGAACTCCACTCATCACCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053083
LOXL4 MISSION shRNA Lentiviral Transduction Particles
lysyl oxidase-like 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053083.1-167s1c1
Sequence:CCGGGCACGGTGTGTGATGATGATTCTCGAGAATCATCATCACACACCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053083.1-1922s1c1
Sequence:CCGGGCTTCTGTCTAGAAGATACAACTCGAGTTGTATCTTCTAGACAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053083.1-327s1c1
Sequence:CCGGCCTAGATCAGTGTGGCTCTAACTCGAGTTAGAGCCACACTGATCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053083.1-291s1c1
Sequence:CCGGGCTGGACAATGTTCGTTGTTTCTCGAGAAACAACGAACATTGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053083.1-1468s1c2
Sequence:CCGGGAAGTGGTGATGAGTGGAGTTCTCGAGAACTCCACTCATCACCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)