EMAIL THIS PAGE TO A FRIEND

LPA

lipoprotein, Lp(a)

34 Gene Product Result for
Synonyms: AK38 APOA LP
Species: Human LPA(4018)
UniProtKB ID: P08519, Q5VTD7, Q9UD88
Gene ID:
Human(4018) Summary: The protein encoded by this gene is a serine proteinase that inhibits the activity of tissue-type plasminogen activator I. The encoded protein constitutes a substantial portion of lipoprotein(a) and is proteolytically cleaved, resulting in fragments that attach to atherosclerotic lesions and promote thrombogenesis. Elevated plasma levels of this protein are linked to atherosclerosis. Depending on the individual, the encoded protein contains 2-43 copies of kringle-type domains. The allele represented here contains 15 copies of the kringle-type repeats and corresponds to that found in the reference genome sequence. [provided by RefSeq, Dec 2009]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005577 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005577 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005577 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005577 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225206 predicted 3443
2 SASI_Hs02_00339859 predicted 4424
3 SASI_Hs01_00225207 predicted 5364
4 SASI_Hs01_00225209 predicted 3077
5 SASI_Hs01_00225210 predicted 4856
6 SASI_Hs02_00339860 predicted 4037
7 SASI_Hs01_00225211 predicted 3798
8 SASI_Hs01_00225212 predicted 3279
9 SASI_Hs01_00225205 predicted 11626
10 SASI_Hs01_00225208 predicted 11843
11 SASI_Hs01_00225213 predicted 10419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005577
LPA MISSION shRNA Bacterial Glycerol Stock
lipoprotein, Lp(a)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005577.2-6260s21c1
Sequence:CCGGGTGAAGCATCAACCTACTTAGCTCGAGCTAAGTAGGTTGATGCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005577.2-5816s21c1
Sequence:CCGGAGCCCACACAAGCAGATATTGCTCGAGCAATATCTGCTTGTGTGGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005577.2-4641s21c1
Sequence:CCGGACGGAGTTATCGAGGCATATCCTCGAGGATATGCCTCGATAACTCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005577.1-7998s1c1
Sequence:CCGGCCACGGTAATGGACAGAGTTACTCGAGTAACTCTGTCCATTACCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005577.1-13368s1c1
Sequence:CCGGCGCCAGGACTGAATGTTACATCTCGAGATGTAACATTCAGTCCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005577.1-10652s1c1
Sequence:CCGGCGAATGTTATTCTGGCTCCAACTCGAGTTGGAGCCAGAATAACATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005577.1-11615s1c1
Sequence:CCGGCGCAATGTCCAGTGATGGAATCTCGAGATTCCATCACTGGACATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005577.1-3721s1c1
Sequence:CCGGCCTTATTGTTATACGAGGGATCTCGAGATCCCTCGTATAACAATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005577
LPA MISSION shRNA shRNA Plasmid DNA
lipoprotein, Lp(a)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005577.2-6260s21c1
Sequence:CCGGGTGAAGCATCAACCTACTTAGCTCGAGCTAAGTAGGTTGATGCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005577.2-5816s21c1
Sequence:CCGGAGCCCACACAAGCAGATATTGCTCGAGCAATATCTGCTTGTGTGGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005577.2-4641s21c1
Sequence:CCGGACGGAGTTATCGAGGCATATCCTCGAGGATATGCCTCGATAACTCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005577.1-7998s1c1
Sequence:CCGGCCACGGTAATGGACAGAGTTACTCGAGTAACTCTGTCCATTACCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005577.1-13368s1c1
Sequence:CCGGCGCCAGGACTGAATGTTACATCTCGAGATGTAACATTCAGTCCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005577.1-10652s1c1
Sequence:CCGGCGAATGTTATTCTGGCTCCAACTCGAGTTGGAGCCAGAATAACATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005577.1-11615s1c1
Sequence:CCGGCGCAATGTCCAGTGATGGAATCTCGAGATTCCATCACTGGACATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005577.1-3721s1c1
Sequence:CCGGCCTTATTGTTATACGAGGGATCTCGAGATCCCTCGTATAACAATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005577
LPA MISSION shRNA Lentiviral Transduction Particles
lipoprotein, Lp(a)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005577.2-6260s21c1
Sequence:CCGGGTGAAGCATCAACCTACTTAGCTCGAGCTAAGTAGGTTGATGCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005577.2-5816s21c1
Sequence:CCGGAGCCCACACAAGCAGATATTGCTCGAGCAATATCTGCTTGTGTGGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005577.2-4641s21c1
Sequence:CCGGACGGAGTTATCGAGGCATATCCTCGAGGATATGCCTCGATAACTCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005577.1-7998s1c1
Sequence:CCGGCCACGGTAATGGACAGAGTTACTCGAGTAACTCTGTCCATTACCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005577.1-13368s1c1
Sequence:CCGGCGCCAGGACTGAATGTTACATCTCGAGATGTAACATTCAGTCCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005577.1-10652s1c1
Sequence:CCGGCGAATGTTATTCTGGCTCCAACTCGAGTTGGAGCCAGAATAACATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005577.1-11615s1c1
Sequence:CCGGCGCAATGTCCAGTGATGGAATCTCGAGATTCCATCACTGGACATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005577.1-3721s1c1
Sequence:CCGGCCTTATTGTTATACGAGGGATCTCGAGATCCCTCGTATAACAATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)