EMAIL THIS PAGE TO A FRIEND

LPAR1

lysophosphatidic acid receptor 1

81 Gene Product Result for
Synonyms: EDG2 GPR26 Gpcr26 LPA1 Mrec1.3 VZG1 edg-2 rec.1.3 vzg-1
UniProtKB ID: Q92633, O00656, O00722, P78351
Gene ID:
Human(1902) Summary: The integral membrane protein encoded by this gene is a lysophosphatidic acid (LPA) receptor from a group known as EDG receptors. These receptors are members of the G protein-coupled receptor superfamily. Utilized by LPA for cell signaling, EDG receptors mediate diverse biologic functions, including proliferation, platelet aggregation, smooth muscle contraction, inhibition of neuroblastoma cell differentiation, chemotaxis, and tumor cell invasion. Two transcript variants encoding the same protein have been identified for this gene [provided by RefSeq, Jul 2008]
Mouse(14745) lysophosphatidic acid receptor 1
Rat(116744) lysophosphatidic acid receptor 1
Zebrafish(368461) lysophosphatidic acid receptor 1
dog(474800) lysophosphatidic acid receptor 1
domestic cat(101092556) lysophosphatidic acid receptor 1
cow(281136) lysophosphatidic acid receptor 1
chicken(427339) lysophosphatidic acid receptor 1
sheep(443346) lysophosphatidic acid receptor 1
domestic guinea pig(100715007) lysophosphatidic acid receptor 1
Domestic Rabbit(100355169) lysophosphatidic acid receptor 1
naked mole-rat(101713333) lysophosphatidic acid receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010336 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010336 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010336 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_057159 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_057159 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_057159 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001401 Rosetta Predictions human pricing
NM_057159 Rosetta Predictions human pricing
NM_053936 Rosetta Predictions rat pricing
NM_010336 Rosetta Predictions mouse pricing
NM_172989 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172897 predicted 1292
2 SASI_Hs01_00172898 predicted 871
3 SASI_Hs01_00172899 predicted 755
4 SASI_Hs01_00172900 predicted 999
5 SASI_Hs02_00331769 predicted 510
6 SASI_Hs01_00172902 predicted 455
7 SASI_Hs01_00172903 predicted 643
8 SASI_Hs01_00172904 predicted 1535
9 SASI_Hs01_00172905 predicted 1411
10 SASI_Hs02_00331770 predicted 607
11 SASI_Hs01_00172896 predicted 521
12 SASI_Hs01_00172901 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013685 predicted 1373
2 SASI_Hs01_00013686 predicted 942
3 SASI_Hs01_00013687 predicted 836
4 SASI_Hs01_00013688 predicted 1078
5 SASI_Hs02_00362014 predicted 590
6 SASI_Hs01_00013690 predicted 536
7 SASI_Hs01_00013691 predicted 725
8 SASI_Hs01_00013692 predicted 1620
9 SASI_Hs01_00013693 predicted 1492
10 SASI_Hs02_00362015 predicted 688
11 SASI_Hs01_00013684 predicted 604
12 SASI_Hs01_00013689 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053936 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108702 predicted 677
2 SASI_Rn01_00108703 predicted 1046
3 SASI_Rn01_00108704 predicted 475
4 SASI_Rn01_00108705 predicted 645
5 SASI_Rn01_00108706 predicted 712
6 SASI_Rn01_00108707 predicted 448
7 SASI_Rn01_00108709 predicted 207
8 SASI_Rn02_00266890 predicted 233
9 SASI_Rn01_00108710 predicted 219
10 SASI_Rn02_00266891 predicted 1216
11 SASI_Rn01_00108708 predicted 937
12 SASI_Rn01_00108711 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010336 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318340 predicted 704
2 SASI_Mm01_00021095 predicted 1084
3 SASI_Mm01_00021096 predicted 483
4 SASI_Mm01_00021098 predicted 959
5 SASI_Mm02_00318341 predicted 510
6 SASI_Mm01_00021100 predicted 892
7 SASI_Mm01_00021101 predicted 832
8 SASI_Mm02_00318342 predicted 675
9 SASI_Mm02_00318343 predicted 358
10 SASI_Mm02_00318344 predicted 1235
11 SASI_Mm01_00021092 predicted 898
12 SASI_Mm01_00021093 predicted 276
13 SASI_Mm01_00021094 predicted 546
14 SASI_Mm01_00021097 predicted 593
15 SASI_Mm01_00021099 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172989 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345030 predicted 792
2 SASI_Mm02_00345031 predicted 1171
3 SASI_Mm02_00345032 predicted 574
4 SASI_Mm02_00345033 predicted 1048
5 SASI_Mm02_00345034 predicted 597
6 SASI_Mm02_00345035 predicted 983
7 SASI_Mm02_00345036 predicted 915
8 SASI_Mm02_00345037 predicted 765
9 SASI_Mm02_00345038 predicted 441
10 SASI_Mm02_00345039 predicted 1319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010336
VALIDATED
LPAR1 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidic acid receptor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010336.1-2548s1c1
Sequence:CCGGGCCAGTATCATTGATGATTTACTCGAGTAAATCATCAATGATACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010336.1-978s1c1
Sequence:CCGGCCTTCTGAAGACTGTGGTCATCTCGAGATGACCACAGTCTTCAGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010336.1-446s1c1
Sequence:CCGGGCCGCTTCCATTTCCCTATTTCTCGAGAAATAGGGAAATGGAAGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010336.1-1113s1c1
Sequence:CCGGCGAGTTCAACTCTGCTATGAACTCGAGTTCATAGCAGAGTTGAACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010336.1-381s1c1
Sequence:CCGGCATCACTGTTTGCGTGTTCATCTCGAGATGAACACGCAAACAGTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010336.2-1418s21c1
Sequence:CCGGAGAGACTTGAGGATGAATTTACTCGAGTAAATTCATCCTCAAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010336.2-419s21c1
Sequence:CCGGGCCGCTTCCATTTCCCTATTTCTCGAGAAATAGGGAAATGGAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010336.2-1172s21c1
Sequence:CCGGAGCGCAACGAGAACCCTAATGCTCGAGCATTAGGGTTCTCGTTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010336.2-1115s21c1
Sequence:CCGGTCTACTCCTACCGCGACAAAGCTCGAGCTTTGTCGCGGTAGGAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010336.2-503s21c1
Sequence:CCGGTGTTCAATACAGGACCTAATACTCGAGTATTAGGTCCTGTATTGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010336
VALIDATED
LPAR1 MISSION shRNA shRNA Plasmid DNA
lysophosphatidic acid receptor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010336.1-2548s1c1
Sequence:CCGGGCCAGTATCATTGATGATTTACTCGAGTAAATCATCAATGATACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010336.1-978s1c1
Sequence:CCGGCCTTCTGAAGACTGTGGTCATCTCGAGATGACCACAGTCTTCAGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010336.1-446s1c1
Sequence:CCGGGCCGCTTCCATTTCCCTATTTCTCGAGAAATAGGGAAATGGAAGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010336.1-1113s1c1
Sequence:CCGGCGAGTTCAACTCTGCTATGAACTCGAGTTCATAGCAGAGTTGAACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010336.1-381s1c1
Sequence:CCGGCATCACTGTTTGCGTGTTCATCTCGAGATGAACACGCAAACAGTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010336.2-1418s21c1
Sequence:CCGGAGAGACTTGAGGATGAATTTACTCGAGTAAATTCATCCTCAAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010336.2-419s21c1
Sequence:CCGGGCCGCTTCCATTTCCCTATTTCTCGAGAAATAGGGAAATGGAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010336.2-1172s21c1
Sequence:CCGGAGCGCAACGAGAACCCTAATGCTCGAGCATTAGGGTTCTCGTTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010336.2-1115s21c1
Sequence:CCGGTCTACTCCTACCGCGACAAAGCTCGAGCTTTGTCGCGGTAGGAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010336.2-503s21c1
Sequence:CCGGTGTTCAATACAGGACCTAATACTCGAGTATTAGGTCCTGTATTGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010336
VALIDATED
LPAR1 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidic acid receptor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010336.1-2548s1c1
Sequence:CCGGGCCAGTATCATTGATGATTTACTCGAGTAAATCATCAATGATACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010336.1-978s1c1
Sequence:CCGGCCTTCTGAAGACTGTGGTCATCTCGAGATGACCACAGTCTTCAGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010336.1-446s1c1
Sequence:CCGGGCCGCTTCCATTTCCCTATTTCTCGAGAAATAGGGAAATGGAAGCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010336.1-1113s1c1
Sequence:CCGGCGAGTTCAACTCTGCTATGAACTCGAGTTCATAGCAGAGTTGAACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010336.1-381s1c1
Sequence:CCGGCATCACTGTTTGCGTGTTCATCTCGAGATGAACACGCAAACAGTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010336.2-1418s21c1
Sequence:CCGGAGAGACTTGAGGATGAATTTACTCGAGTAAATTCATCCTCAAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010336.2-419s21c1
Sequence:CCGGGCCGCTTCCATTTCCCTATTTCTCGAGAAATAGGGAAATGGAAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010336.2-1172s21c1
Sequence:CCGGAGCGCAACGAGAACCCTAATGCTCGAGCATTAGGGTTCTCGTTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010336.2-1115s21c1
Sequence:CCGGTCTACTCCTACCGCGACAAAGCTCGAGCTTTGTCGCGGTAGGAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010336.2-503s21c1
Sequence:CCGGTGTTCAATACAGGACCTAATACTCGAGTATTAGGTCCTGTATTGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_057159
VALIDATED
LPAR1 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidic acid receptor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057159.2-949s1c1
Sequence:CCGGGCCATCGTTATGGGTGCTATACTCGAGTATAGCACCCATAACGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057159.2-627s1c1
Sequence:CCGGCCTATTGGTCATGGTGGCAATCTCGAGATTGCCACCATGACCAATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_057159.2-1174s1c1
Sequence:CCGGCGGGATACCATGATGAGTCTTCTCGAGAAGACTCATCATGGTATCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_057159.2-1297s1c1
Sequence:CCGGGCCTATGAGAAATTCTTCCTTCTCGAGAAGGAAGAATTTCTCATAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_057159.2-1355s21c1
Sequence:CCGGTTTACTCCTACCGCGACAAAGCTCGAGCTTTGTCGCGGTAGGAGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_057159.2-1622s21c1
Sequence:CCGGAGTCAACTCATGTACTTAAACCTCGAGGTTTAAGTACATGAGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057159.2-1921s21c1
Sequence:CCGGAGGATACGTTTCACTTAATAACTCGAGTTATTAAGTGAAACGTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057159.2-940s21c1
Sequence:CCGGTGGACTATGGCCATCGTTATGCTCGAGCATAACGATGGCCATAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_057159.2-744s21c1
Sequence:CCGGGTTCAACACAGGACCCAATACCTCGAGGTATTGGGTCCTGTGTTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_057159.2-851s21c1
Sequence:CCGGTTGCAATCGAGAGGCACATTACTCGAGTAATGTGCCTCTCGATTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_057159
VALIDATED
LPAR1 MISSION shRNA shRNA Plasmid DNA
lysophosphatidic acid receptor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057159.2-949s1c1
Sequence:CCGGGCCATCGTTATGGGTGCTATACTCGAGTATAGCACCCATAACGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057159.2-627s1c1
Sequence:CCGGCCTATTGGTCATGGTGGCAATCTCGAGATTGCCACCATGACCAATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_057159.2-1174s1c1
Sequence:CCGGCGGGATACCATGATGAGTCTTCTCGAGAAGACTCATCATGGTATCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_057159.2-1297s1c1
Sequence:CCGGGCCTATGAGAAATTCTTCCTTCTCGAGAAGGAAGAATTTCTCATAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_057159.2-1355s21c1
Sequence:CCGGTTTACTCCTACCGCGACAAAGCTCGAGCTTTGTCGCGGTAGGAGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_057159.2-1622s21c1
Sequence:CCGGAGTCAACTCATGTACTTAAACCTCGAGGTTTAAGTACATGAGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057159.2-1921s21c1
Sequence:CCGGAGGATACGTTTCACTTAATAACTCGAGTTATTAAGTGAAACGTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057159.2-940s21c1
Sequence:CCGGTGGACTATGGCCATCGTTATGCTCGAGCATAACGATGGCCATAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_057159.2-744s21c1
Sequence:CCGGGTTCAACACAGGACCCAATACCTCGAGGTATTGGGTCCTGTGTTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_057159.2-851s21c1
Sequence:CCGGTTGCAATCGAGAGGCACATTACTCGAGTAATGTGCCTCTCGATTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_057159
VALIDATED
LPAR1 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidic acid receptor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057159.2-949s1c1
Sequence:CCGGGCCATCGTTATGGGTGCTATACTCGAGTATAGCACCCATAACGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057159.2-627s1c1
Sequence:CCGGCCTATTGGTCATGGTGGCAATCTCGAGATTGCCACCATGACCAATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_057159.2-1174s1c1
Sequence:CCGGCGGGATACCATGATGAGTCTTCTCGAGAAGACTCATCATGGTATCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_057159.2-1297s1c1
Sequence:CCGGGCCTATGAGAAATTCTTCCTTCTCGAGAAGGAAGAATTTCTCATAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_057159.2-1355s21c1
Sequence:CCGGTTTACTCCTACCGCGACAAAGCTCGAGCTTTGTCGCGGTAGGAGTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_057159.2-1622s21c1
Sequence:CCGGAGTCAACTCATGTACTTAAACCTCGAGGTTTAAGTACATGAGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057159.2-1921s21c1
Sequence:CCGGAGGATACGTTTCACTTAATAACTCGAGTTATTAAGTGAAACGTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057159.2-940s21c1
Sequence:CCGGTGGACTATGGCCATCGTTATGCTCGAGCATAACGATGGCCATAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_057159.2-744s21c1
Sequence:CCGGGTTCAACACAGGACCCAATACCTCGAGGTATTGGGTCCTGTGTTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_057159.2-851s21c1
Sequence:CCGGTTGCAATCGAGAGGCACATTACTCGAGTAATGTGCCTCTCGATTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)