EMAIL THIS PAGE TO A FRIEND

LPAR2

lysophosphatidic acid receptor 2

65 Gene Product Result for
Synonyms: EDG-4 EDG4 LPA-2 LPA2
UniProtKB ID: Q9HBW0, O00543, O43431
Gene ID:
Human(9170) Summary: This gene encodes a member of family I of the G protein-coupled receptors, as well as the EDG family of proteins. This protein functions as a lysophosphatidic acid (LPA) receptor and contributes to Ca2+ mobilization, a critical cellular response to LPA in cells, through association with Gi and Gq proteins. An alternative splice variant has been described but its full length sequence has not been determined. [provided by RefSeq, Jul 2008]
Mouse(53978) lysophosphatidic acid receptor 2
Rat(498609) lysophosphatidic acid receptor 2
naked mole-rat(101721970) lysophosphatidic acid receptor 2
domestic guinea pig(100719671) lysophosphatidic acid receptor 2
sheep(101104572) lysophosphatidic acid receptor 2
chicken(426086) lysophosphatidic acid receptor 2
domestic cat(101100950) lysophosphatidic acid receptor 2
cow(509748) lysophosphatidic acid receptor 2
dog(484802) lysophosphatidic acid receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004720 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020028 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020028 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020028 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004720 Rosetta Predictions human pricing
NM_001109109 Rosetta Predictions rat pricing
XR_008774 Rosetta Predictions rat pricing
NM_020028 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175376 predicted 1188
2 SASI_Hs01_00175378 predicted 380
3 SASI_Hs01_00175379 predicted 1448
4 SASI_Hs02_00338192 predicted 320
5 SASI_Hs01_00175380 predicted 1142
6 SASI_Hs01_00175381 predicted 1282
7 SASI_Hs01_00175382 predicted 1490
8 SASI_Hs01_00175384 predicted 684
9 SASI_Hs01_00175385 predicted 1416
10 SASI_Hs02_00338193 predicted 845
11 SASI_Hs01_00175377 predicted 827
12 SASI_Hs01_00175383 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245210 predicted 1052
2 SASI_Rn02_00245211 predicted 814
3 SASI_Rn02_00245212 predicted 895
4 SASI_Rn02_00245213 predicted 837
5 SASI_Rn02_00245214 predicted 1311
6 SASI_Rn02_00245215 predicted 1104
7 SASI_Rn02_00245216 predicted 677
8 SASI_Rn02_00245217 predicted 237
9 SASI_Rn02_00245218 predicted 275
10 SASI_Rn02_00245219 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00149924 predicted 1068
2 SASI_Rn01_00149925 predicted 907
3 SASI_Rn01_00149926 predicted 1119
4 SASI_Rn01_00149927 predicted 689
5 SASI_Rn01_00149928 predicted 356
6 SASI_Rn01_00149929 predicted 1124
7 SASI_Rn01_00149930 predicted 1062
8 SASI_Rn01_00149931 predicted 293
9 SASI_Rn01_00149932 predicted 971
10 SASI_Rn01_00149933 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165280 predicted 1544
2 SASI_Mm01_00165282 predicted 1542
3 SASI_Mm01_00165284 predicted 1518
4 SASI_Mm01_00165285 predicted 1145
5 SASI_Mm01_00165286 predicted 942
6 SASI_Mm01_00165287 predicted 1493
7 SASI_Mm01_00165288 predicted 1498
8 SASI_Mm01_00165289 predicted 1025
9 SASI_Mm02_00325394 predicted 1576
10 SASI_Mm02_00325395 predicted 1105
11 SASI_Mm01_00165281 predicted 1568
12 SASI_Mm01_00165283 predicted 543
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004720
LPAR2 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidic acid receptor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004720.5-993s21c1
Sequence:CCGGAGGCCAACTCACTGGTCAATGCTCGAGCATTGACCAGTGAGTTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004720.5-1575s21c1
Sequence:CCGGACCCGGTATGACTGGGTAATGCTCGAGCATTACCCAGTCATACCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004720.5-173s21c1
Sequence:CCGGACCATCGGCTTCTTCTATAACCTCGAGGTTATAGAAGAAGCCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004720.4-1658s1c1
Sequence:CCGGTCTACCTGAGTCTGATTCTTTCTCGAGAAAGAATCAGACTCAGGTAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004720.4-224s1c1
Sequence:CCGGCTTCTATAACAACAGTGGCAACTCGAGTTGCCACTGTTGTTATAGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004720.4-320s1c1
Sequence:CCGGGCTGACCAATCTGCTGGTCATCTCGAGATGACCAGCAGATTGGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004720.4-893s1c1
Sequence:CCGGCCTGGTCAAGACTGTTGTCATCTCGAGATGACAACAGTCTTGACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004720.4-1138s1c1
Sequence:CCGGGCGAGTCTGTCCACTATACATCTCGAGATGTATAGTGGACAGACTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004720
LPAR2 MISSION shRNA shRNA Plasmid DNA
lysophosphatidic acid receptor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004720.5-993s21c1
Sequence:CCGGAGGCCAACTCACTGGTCAATGCTCGAGCATTGACCAGTGAGTTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004720.5-1575s21c1
Sequence:CCGGACCCGGTATGACTGGGTAATGCTCGAGCATTACCCAGTCATACCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004720.5-173s21c1
Sequence:CCGGACCATCGGCTTCTTCTATAACCTCGAGGTTATAGAAGAAGCCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004720.4-1658s1c1
Sequence:CCGGTCTACCTGAGTCTGATTCTTTCTCGAGAAAGAATCAGACTCAGGTAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004720.4-224s1c1
Sequence:CCGGCTTCTATAACAACAGTGGCAACTCGAGTTGCCACTGTTGTTATAGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004720.4-320s1c1
Sequence:CCGGGCTGACCAATCTGCTGGTCATCTCGAGATGACCAGCAGATTGGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004720.4-893s1c1
Sequence:CCGGCCTGGTCAAGACTGTTGTCATCTCGAGATGACAACAGTCTTGACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004720.4-1138s1c1
Sequence:CCGGGCGAGTCTGTCCACTATACATCTCGAGATGTATAGTGGACAGACTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004720
LPAR2 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidic acid receptor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004720.5-993s21c1
Sequence:CCGGAGGCCAACTCACTGGTCAATGCTCGAGCATTGACCAGTGAGTTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004720.5-1575s21c1
Sequence:CCGGACCCGGTATGACTGGGTAATGCTCGAGCATTACCCAGTCATACCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004720.5-173s21c1
Sequence:CCGGACCATCGGCTTCTTCTATAACCTCGAGGTTATAGAAGAAGCCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004720.4-1658s1c1
Sequence:CCGGTCTACCTGAGTCTGATTCTTTCTCGAGAAAGAATCAGACTCAGGTAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004720.4-224s1c1
Sequence:CCGGCTTCTATAACAACAGTGGCAACTCGAGTTGCCACTGTTGTTATAGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004720.4-320s1c1
Sequence:CCGGGCTGACCAATCTGCTGGTCATCTCGAGATGACCAGCAGATTGGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004720.4-893s1c1
Sequence:CCGGCCTGGTCAAGACTGTTGTCATCTCGAGATGACAACAGTCTTGACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004720.4-1138s1c1
Sequence:CCGGGCGAGTCTGTCCACTATACATCTCGAGATGTATAGTGGACAGACTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020028
LPAR2 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidic acid receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020028.3-3479s21c1
Sequence:GTACCGGAGATGCTATCCAGGGATTTATCTCGAGATAAATCCCTGGATAGCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020028.3-1184s21c1
Sequence:CCGGTGATGGACTCCACCCTTTAAACTCGAGTTTAAAGGGTGGAGTCCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020028.3-1013s21c1
Sequence:CCGGTGGTCAATGCAGTGGTATATTCTCGAGAATATACCACTGCATTGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020028.3-761s21c1
Sequence:CCGGTAGCTGTCTACACACGAATTTCTCGAGAAATTCGTGTGTAGACAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020028.3-330s21c1
Sequence:CCGGACGCTTCCACCAGCCCATATACTCGAGTATATGGGCTGGTGGAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020028
LPAR2 MISSION shRNA shRNA Plasmid DNA
lysophosphatidic acid receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020028.3-3479s21c1
Sequence:GTACCGGAGATGCTATCCAGGGATTTATCTCGAGATAAATCCCTGGATAGCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020028.3-1184s21c1
Sequence:CCGGTGATGGACTCCACCCTTTAAACTCGAGTTTAAAGGGTGGAGTCCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020028.3-1013s21c1
Sequence:CCGGTGGTCAATGCAGTGGTATATTCTCGAGAATATACCACTGCATTGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020028.3-761s21c1
Sequence:CCGGTAGCTGTCTACACACGAATTTCTCGAGAAATTCGTGTGTAGACAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020028.3-330s21c1
Sequence:CCGGACGCTTCCACCAGCCCATATACTCGAGTATATGGGCTGGTGGAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020028
LPAR2 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidic acid receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020028.3-3479s21c1
Sequence:GTACCGGAGATGCTATCCAGGGATTTATCTCGAGATAAATCCCTGGATAGCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020028.3-1184s21c1
Sequence:CCGGTGATGGACTCCACCCTTTAAACTCGAGTTTAAAGGGTGGAGTCCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020028.3-1013s21c1
Sequence:CCGGTGGTCAATGCAGTGGTATATTCTCGAGAATATACCACTGCATTGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020028.3-761s21c1
Sequence:CCGGTAGCTGTCTACACACGAATTTCTCGAGAAATTCGTGTGTAGACAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020028.3-330s21c1
Sequence:CCGGACGCTTCCACCAGCCCATATACTCGAGTATATGGGCTGGTGGAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)