EMAIL THIS PAGE TO A FRIEND

LPAR3

lysophosphatidic acid receptor 3

52 Gene Product Result for
Synonyms: EDG7 Edg-7 GPCR HOFNH30 LP-A3 LPA3 RP4-678I3
UniProtKB ID: Q9UBY5, A0AVA3
Gene ID:
Human(23566) Summary: This gene encodes a member of the G protein-coupled receptor family, as well as the EDG family of proteins. This protein functions as a cellular receptor for lysophosphatidic acid and mediates lysophosphatidic acid-evoked calcium mobilization. This receptor couples predominantly to G(q/11) alpha proteins. [provided by RefSeq, Jul 2008]
Mouse(65086) lysophosphatidic acid receptor 3
Rat(66025) lysophosphatidic acid receptor 3
chicken(771215) lysophosphatidic acid receptor 3
dog(490187) lysophosphatidic acid receptor 3
domestic cat(101097996) lysophosphatidic acid receptor 3
cow(532829) lysophosphatidic acid receptor 3
sheep(101111138) lysophosphatidic acid receptor 3
domestic guinea pig(100730869) lysophosphatidic acid receptor 3
naked mole-rat(101716212) lysophosphatidic acid receptor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012152 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022983 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022983 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022983 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012152 Rosetta Predictions human pricing
NM_023969 Rosetta Predictions rat pricing
NM_022983 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036116 predicted 899
2 SASI_Hs02_00343735 predicted 714
3 SASI_Hs01_00036118 predicted 1013
4 SASI_Hs01_00036119 predicted 863
5 SASI_Hs01_00036120 predicted 832
6 SASI_Hs01_00036121 predicted 1092
7 SASI_Hs01_00036122 predicted 1057
8 SASI_Hs01_00036123 predicted 948
9 SASI_Hs01_00036124 predicted 558
10 SASI_Hs01_00036125 predicted 796
11 SASI_Hs01_00036117 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023969 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071568 predicted 1496
2 SASI_Rn01_00071569 predicted 1488
3 SASI_Rn01_00071570 predicted 227
4 SASI_Rn01_00071572 predicted 518
5 SASI_Rn01_00071573 predicted 685
6 SASI_Rn01_00071574 predicted 1118
7 SASI_Rn01_00071575 predicted 477
8 SASI_Rn01_00071576 predicted 205
9 SASI_Rn01_00071577 predicted 604
10 SASI_Rn02_00263777 predicted 1177
11 SASI_Rn01_00071571 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022983 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022765 predicted 792
2 SASI_Mm01_00022767 predicted 352
3 SASI_Mm01_00022768 predicted 419
4 SASI_Mm01_00022769 predicted 258
5 SASI_Mm01_00022770 predicted 399
6 SASI_Mm02_00326707 predicted 1063
7 SASI_Mm01_00022771 predicted 328
8 SASI_Mm01_00022772 predicted 1391
9 SASI_Mm01_00022773 predicted 1542
10 SASI_Mm01_00022774 predicted 1454
11 SASI_Mm01_00022766 predicted 836
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012152
LPAR3 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidic acid receptor 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012152.1-265s1c1
Sequence:CCGGGCCGATTTCTTCGCTGGAATTCTCGAGAATTCCAGCGAAGAAATCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012152.1-747s1c1
Sequence:CCGGGAAGCTAATGAAGACGGTGATCTCGAGATCACCGTCTTCATTAGCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012152.1-888s1c1
Sequence:CCGGGCTGCTCAACTCCGTCGTGAACTCGAGTTCACGACGGAGTTGAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012152.1-390s1c1
Sequence:CCGGCCTCACCAACTTGCTGGTTATCTCGAGATAACCAGCAAGTTGGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012152.1-286s1c1
Sequence:CCGGGCCTATGTATTCCTGATGTTTCTCGAGAAACATCAGGAATACATAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012152.2-1336s21c1
Sequence:CCGGGATTACCTGTCTCTAACAAAGCTCGAGCTTTGTTAGAGACAGGTAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012152.2-1383s21c1
Sequence:CCGGCCATTAATCACTGCTAGATTTCTCGAGAAATCTAGCAGTGATTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012152.2-1222s21c1
Sequence:CCGGCAGTACATAGAGGATAGTATTCTCGAGAATACTATCCTCTATGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012152.2-411s21c1
Sequence:CCGGCTACTACCTGTTGGCTAATTTCTCGAGAAATTAGCCAACAGGTAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012152
LPAR3 MISSION shRNA shRNA Plasmid DNA
lysophosphatidic acid receptor 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012152.1-265s1c1
Sequence:CCGGGCCGATTTCTTCGCTGGAATTCTCGAGAATTCCAGCGAAGAAATCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012152.1-747s1c1
Sequence:CCGGGAAGCTAATGAAGACGGTGATCTCGAGATCACCGTCTTCATTAGCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012152.1-888s1c1
Sequence:CCGGGCTGCTCAACTCCGTCGTGAACTCGAGTTCACGACGGAGTTGAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012152.1-390s1c1
Sequence:CCGGCCTCACCAACTTGCTGGTTATCTCGAGATAACCAGCAAGTTGGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012152.1-286s1c1
Sequence:CCGGGCCTATGTATTCCTGATGTTTCTCGAGAAACATCAGGAATACATAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012152.2-1336s21c1
Sequence:CCGGGATTACCTGTCTCTAACAAAGCTCGAGCTTTGTTAGAGACAGGTAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012152.2-1383s21c1
Sequence:CCGGCCATTAATCACTGCTAGATTTCTCGAGAAATCTAGCAGTGATTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012152.2-1222s21c1
Sequence:CCGGCAGTACATAGAGGATAGTATTCTCGAGAATACTATCCTCTATGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012152.2-411s21c1
Sequence:CCGGCTACTACCTGTTGGCTAATTTCTCGAGAAATTAGCCAACAGGTAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012152
LPAR3 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidic acid receptor 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012152.1-265s1c1
Sequence:CCGGGCCGATTTCTTCGCTGGAATTCTCGAGAATTCCAGCGAAGAAATCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012152.1-747s1c1
Sequence:CCGGGAAGCTAATGAAGACGGTGATCTCGAGATCACCGTCTTCATTAGCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012152.1-888s1c1
Sequence:CCGGGCTGCTCAACTCCGTCGTGAACTCGAGTTCACGACGGAGTTGAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012152.1-390s1c1
Sequence:CCGGCCTCACCAACTTGCTGGTTATCTCGAGATAACCAGCAAGTTGGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012152.1-286s1c1
Sequence:CCGGGCCTATGTATTCCTGATGTTTCTCGAGAAACATCAGGAATACATAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012152.2-1336s21c1
Sequence:CCGGGATTACCTGTCTCTAACAAAGCTCGAGCTTTGTTAGAGACAGGTAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012152.2-1383s21c1
Sequence:CCGGCCATTAATCACTGCTAGATTTCTCGAGAAATCTAGCAGTGATTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012152.2-1222s21c1
Sequence:CCGGCAGTACATAGAGGATAGTATTCTCGAGAATACTATCCTCTATGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012152.2-411s21c1
Sequence:CCGGCTACTACCTGTTGGCTAATTTCTCGAGAAATTAGCCAACAGGTAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022983
LPAR3 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidic acid receptor 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022983.2-1779s1c1
Sequence:CCGGGCGTCAAATATGAGCACGATTCTCGAGAATCGTGCTCATATTTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022983.2-725s1c1
Sequence:CCGGTCCCATTTACAGTAGGAGTTACTCGAGTAACTCCTACTGTAAATGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022983.2-394s1c1
Sequence:CCGGCTAACTTAGCTGCTGCGGATTCTCGAGAATCCGCAGCAGCTAAGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022983.2-899s1c1
Sequence:CCGGGAAGACAGTGATGACCGTCTTCTCGAGAAGACGGTCATCACTGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022983.2-429s1c1
Sequence:CCGGGCTTACGTGTTCCTGATGTTTCTCGAGAAACATCAGGAACACGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022983
LPAR3 MISSION shRNA shRNA Plasmid DNA
lysophosphatidic acid receptor 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022983.2-1779s1c1
Sequence:CCGGGCGTCAAATATGAGCACGATTCTCGAGAATCGTGCTCATATTTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022983.2-725s1c1
Sequence:CCGGTCCCATTTACAGTAGGAGTTACTCGAGTAACTCCTACTGTAAATGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022983.2-394s1c1
Sequence:CCGGCTAACTTAGCTGCTGCGGATTCTCGAGAATCCGCAGCAGCTAAGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022983.2-899s1c1
Sequence:CCGGGAAGACAGTGATGACCGTCTTCTCGAGAAGACGGTCATCACTGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022983.2-429s1c1
Sequence:CCGGGCTTACGTGTTCCTGATGTTTCTCGAGAAACATCAGGAACACGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022983
LPAR3 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidic acid receptor 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022983.2-1779s1c1
Sequence:CCGGGCGTCAAATATGAGCACGATTCTCGAGAATCGTGCTCATATTTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022983.2-725s1c1
Sequence:CCGGTCCCATTTACAGTAGGAGTTACTCGAGTAACTCCTACTGTAAATGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022983.2-394s1c1
Sequence:CCGGCTAACTTAGCTGCTGCGGATTCTCGAGAATCCGCAGCAGCTAAGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022983.2-899s1c1
Sequence:CCGGGAAGACAGTGATGACCGTCTTCTCGAGAAGACGGTCATCACTGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022983.2-429s1c1
Sequence:CCGGGCTTACGTGTTCCTGATGTTTCTCGAGAAACATCAGGAACACGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)