EMAIL THIS PAGE TO A FRIEND

LPAR4

lysophosphatidic acid receptor 4

88 Gene Product Result for
Synonyms: GPR23 LPA4 P2RY9 P2Y5-LIKE P2Y9
UniProtKB ID: Q99677, B2RAC7, O15132, Q502U9, Q6NSP5
Gene ID:
Human(2846) Summary: This gene encodes a member of the lysophosphatidic acid receptor family. It may also be related to the P2Y receptors, a family of receptors that bind purine and pyrimidine nucleotides and are coupled to G proteins. The encoded protein may play a role in monocytic differentiation. [provided by RefSeq, Feb 2009]
Mouse(78134) lysophosphatidic acid receptor 4
Rat(302378) lysophosphatidic acid receptor 4
Domestic Rabbit(100344512) lysophosphatidic acid receptor 4
sheep(101118506) lysophosphatidic acid receptor 4
chicken(422149) lysophosphatidic acid receptor 4
cow(539738) lysophosphatidic acid receptor 4
domestic cat(101087973) lysophosphatidic acid receptor 4
dog(491978) lysophosphatidic acid receptor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P178 Pyridoxal phosphate-6-azo(benzene-2,4-disulfonic acid) tetrasodium salt hydrate solid, ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005296 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175271 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175271 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175271 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005296 Rosetta Predictions human pricing
NM_001106940 Rosetta Predictions rat pricing
NM_175271 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236221 predicted 929
2 SASI_Hs01_00236222 predicted 397
3 SASI_Hs01_00236223 predicted 1275
4 SASI_Hs01_00236224 predicted 773
5 SASI_Hs01_00236225 predicted 1239
6 SASI_Hs01_00236226 predicted 1021
7 SASI_Hs01_00236227 predicted 568
8 SASI_Hs01_00236228 predicted 815
9 SASI_Hs01_00236229 predicted 297
10 SASI_Hs01_00236230 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106940 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223906 predicted 1157
2 SASI_Rn02_00223907 predicted 942
3 SASI_Rn02_00223908 predicted 1325
4 SASI_Rn02_00223909 predicted 1413
5 SASI_Rn02_00223910 predicted 623
6 SASI_Rn02_00223911 predicted 681
7 SASI_Rn02_00223912 predicted 1332
8 SASI_Rn02_00223913 predicted 1258
9 SASI_Rn02_00223914 predicted 1568
10 SASI_Rn02_00223915 predicted 1690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175271 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192907 predicted 1595
2 SASI_Mm01_00192908 predicted 845
3 SASI_Mm01_00192909 predicted 1588
4 SASI_Mm01_00192910 predicted 902
5 SASI_Mm01_00192911 predicted 993
6 SASI_Mm01_00192912 predicted 1010
7 SASI_Mm01_00192913 predicted 1551
8 SASI_Mm01_00192915 predicted 1541
9 SASI_Mm01_00192916 predicted 1590
10 SASI_Mm02_00345986 predicted 917
11 SASI_Mm01_00192914 predicted 1004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005296
LPAR4 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidic acid receptor 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005296.2-1847s21c1
Sequence:CCGGTAATTAGGTTGGGCCTATAAACTCGAGTTTATAGGCCCAACCTAATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005296.2-1226s21c1
Sequence:CCGGTGGTGCGCTCCCAAGCTATTACTCGAGTAATAGCTTGGGAGCGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005296.1-832s1c1
Sequence:CCGGGCAGTCTTTGTGGTATGCTTTCTCGAGAAAGCATACCACAAAGACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005296.1-415s1c1
Sequence:CCGGGCATTCCTTACCAACATCTATCTCGAGATAGATGTTGGTAAGGAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005296.1-1201s1c1
Sequence:CCGGCCAGATATGGTTTCTCCTATACTCGAGTATAGGAGAAACCATATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005296.1-649s1c1
Sequence:CCGGCGTGTCTGGAAGACTTATTTACTCGAGTAAATAAGTCTTCCAGACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005296.1-897s1c1
Sequence:CCGGCCAAGCTATTACTAATTGCTTCTCGAGAAGCAATTAGTAATAGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005296.2-899s21c1
Sequence:CCGGTAGTCCTCAGTGGCGGTATTTCTCGAGAAATACCGCCACTGAGGACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005296
LPAR4 MISSION shRNA shRNA Plasmid DNA
lysophosphatidic acid receptor 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005296.2-1847s21c1
Sequence:CCGGTAATTAGGTTGGGCCTATAAACTCGAGTTTATAGGCCCAACCTAATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005296.2-1226s21c1
Sequence:CCGGTGGTGCGCTCCCAAGCTATTACTCGAGTAATAGCTTGGGAGCGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005296.1-832s1c1
Sequence:CCGGGCAGTCTTTGTGGTATGCTTTCTCGAGAAAGCATACCACAAAGACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005296.1-415s1c1
Sequence:CCGGGCATTCCTTACCAACATCTATCTCGAGATAGATGTTGGTAAGGAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005296.1-1201s1c1
Sequence:CCGGCCAGATATGGTTTCTCCTATACTCGAGTATAGGAGAAACCATATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005296.1-649s1c1
Sequence:CCGGCGTGTCTGGAAGACTTATTTACTCGAGTAAATAAGTCTTCCAGACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005296.1-897s1c1
Sequence:CCGGCCAAGCTATTACTAATTGCTTCTCGAGAAGCAATTAGTAATAGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005296.2-899s21c1
Sequence:CCGGTAGTCCTCAGTGGCGGTATTTCTCGAGAAATACCGCCACTGAGGACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005296
LPAR4 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidic acid receptor 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005296.2-1847s21c1
Sequence:CCGGTAATTAGGTTGGGCCTATAAACTCGAGTTTATAGGCCCAACCTAATTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000357143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005296.2-1226s21c1
Sequence:CCGGTGGTGCGCTCCCAAGCTATTACTCGAGTAATAGCTTGGGAGCGCACCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005296.1-832s1c1
Sequence:CCGGGCAGTCTTTGTGGTATGCTTTCTCGAGAAAGCATACCACAAAGACTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005296.1-415s1c1
Sequence:CCGGGCATTCCTTACCAACATCTATCTCGAGATAGATGTTGGTAAGGAATGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005296.1-1201s1c1
Sequence:CCGGCCAGATATGGTTTCTCCTATACTCGAGTATAGGAGAAACCATATCTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005296.1-649s1c1
Sequence:CCGGCGTGTCTGGAAGACTTATTTACTCGAGTAAATAAGTCTTCCAGACACGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005296.1-897s1c1
Sequence:CCGGCCAAGCTATTACTAATTGCTTCTCGAGAAGCAATTAGTAATAGCTTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000357144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005296.2-899s21c1
Sequence:CCGGTAGTCCTCAGTGGCGGTATTTCTCGAGAAATACCGCCACTGAGGACTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175271
VALIDATED
LPAR4 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidic acid receptor 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175271.4-1985s21c1
Sequence:CCGGTAATTGGGTTGGGCCTATAAACTCGAGTTTATAGGCCCAACCCAATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175271.4-695s21c1
Sequence:CCGGTATTCATCCTGGGTCTAATAACTCGAGTTATTAGACCCAGGATGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175271.4-1447s21c1
Sequence:CCGGGCAACTCTGAATTGTTGCTTTCTCGAGAAAGCAACAATTCAGAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175271.4-1044s21c1
Sequence:CCGGAGTCCTCAGTGGTGGTATTTCCTCGAGGAAATACCACCACTGAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175271.2-1285s1c1
Sequence:CCGGGCAGTGTTTGTGGTATGCTTTCTCGAGAAAGCATACCACAAACACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175271.2-1417s1c1
Sequence:CCGGGCAACTCTGAATTGTTGCTTTCTCGAGAAAGCAACAATTCAGAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175271.4-1147s21c1
Sequence:CCGGTACCTGTCCAAGATCACTATACTCGAGTATAGTGATCTTGGACAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175271.2-1119s1c1
Sequence:CCGGCCTGTCCAAGATCACTATATTCTCGAGAATATAGTGATCTTGGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175271.2-935s1c1
Sequence:CCGGCCATTGTCTATCCCTTCCGATCTCGAGATCGGAAGGGATAGACAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175271.2-1589s1c1
Sequence:CCGGCAACAAATAATGGTGGTGAATCTCGAGATTCACCACCATTATTTGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175271
VALIDATED
LPAR4 MISSION shRNA shRNA Plasmid DNA
lysophosphatidic acid receptor 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175271.4-1985s21c1
Sequence:CCGGTAATTGGGTTGGGCCTATAAACTCGAGTTTATAGGCCCAACCCAATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175271.4-695s21c1
Sequence:CCGGTATTCATCCTGGGTCTAATAACTCGAGTTATTAGACCCAGGATGAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175271.4-1447s21c1
Sequence:CCGGGCAACTCTGAATTGTTGCTTTCTCGAGAAAGCAACAATTCAGAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175271.4-1044s21c1
Sequence:CCGGAGTCCTCAGTGGTGGTATTTCCTCGAGGAAATACCACCACTGAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175271.2-1285s1c1
Sequence:CCGGGCAGTGTTTGTGGTATGCTTTCTCGAGAAAGCATACCACAAACACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175271.2-1417s1c1
Sequence:CCGGGCAACTCTGAATTGTTGCTTTCTCGAGAAAGCAACAATTCAGAGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175271.4-1147s21c1
Sequence:CCGGTACCTGTCCAAGATCACTATACTCGAGTATAGTGATCTTGGACAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175271.2-1119s1c1
Sequence:CCGGCCTGTCCAAGATCACTATATTCTCGAGAATATAGTGATCTTGGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175271.2-935s1c1
Sequence:CCGGCCATTGTCTATCCCTTCCGATCTCGAGATCGGAAGGGATAGACAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175271.2-1589s1c1
Sequence:CCGGCAACAAATAATGGTGGTGAATCTCGAGATTCACCACCATTATTTGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175271
VALIDATED
LPAR4 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidic acid receptor 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175271.4-1985s21c1
Sequence:CCGGTAATTGGGTTGGGCCTATAAACTCGAGTTTATAGGCCCAACCCAATTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000340828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175271.4-695s21c1
Sequence:CCGGTATTCATCCTGGGTCTAATAACTCGAGTTATTAGACCCAGGATGAATATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000340827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175271.4-1447s21c1
Sequence:CCGGGCAACTCTGAATTGTTGCTTTCTCGAGAAAGCAACAATTCAGAGTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000352541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175271.4-1044s21c1
Sequence:CCGGAGTCCTCAGTGGTGGTATTTCCTCGAGGAAATACCACCACTGAGGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175271.2-1285s1c1
Sequence:CCGGGCAGTGTTTGTGGTATGCTTTCTCGAGAAAGCATACCACAAACACTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175271.2-1417s1c1
Sequence:CCGGGCAACTCTGAATTGTTGCTTTCTCGAGAAAGCAACAATTCAGAGTTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000352542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175271.4-1147s21c1
Sequence:CCGGTACCTGTCCAAGATCACTATACTCGAGTATAGTGATCTTGGACAGGTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175271.2-1119s1c1
Sequence:CCGGCCTGTCCAAGATCACTATATTCTCGAGAATATAGTGATCTTGGACAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175271.2-935s1c1
Sequence:CCGGCCATTGTCTATCCCTTCCGATCTCGAGATCGGAAGGGATAGACAATGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000026358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175271.2-1589s1c1
Sequence:CCGGCAACAAATAATGGTGGTGAATCTCGAGATTCACCACCATTATTTGTTGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???