EMAIL THIS PAGE TO A FRIEND

LPAR5

lysophosphatidic acid receptor 5

77 Gene Product Result for
Synonyms: GPR92 GPR93 KPG_010 LPA5
UniProtKB ID: Q9H1C0
Gene ID:
Human(57121) Summary: This gene encodes a member of the rhodopsin class of G protein-coupled transmembrane receptors. This protein transmits extracellular signals from lysophosphatidic acid to cells through heterotrimeric G proteins and mediates numerous cellular processes. Many G protein receptors serve as targets for pharmaceutical drugs. Transcript variants of this gene have been described.[provided by RefSeq, Dec 2008]
Mouse(381810) lysophosphatidic acid receptor 5
Rat(500317) lysophosphatidic acid receptor 5
chicken(418279) lysophosphatidic acid receptor 5
cow(507598) lysophosphatidic acid receptor 5
dog(486724) lysophosphatidic acid receptor 5
sheep(101109610) lysophosphatidic acid receptor 5
domestic guinea pig(100735335) lysophosphatidic acid receptor 5
naked mole-rat(101716148) lysophosphatidic acid receptor 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020400 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020400 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020400 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_355812 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355812 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355812 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU079481 MISSION® esiRNA esiRNA targeting mouse Lpar5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020400 Rosetta Predictions human pricing
XM_001063300 Rosetta Predictions rat pricing
XM_575667 Rosetta Predictions rat pricing
XM_355812 Rosetta Predictions mouse pricing
XM_917685 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180025 predicted 1604
2 SASI_Hs01_00180026 predicted 1669
3 SASI_Hs01_00180027 predicted 1940
4 SASI_Hs01_00180028 predicted 2043
5 SASI_Hs01_00180029 predicted 943
6 SASI_Hs01_00180030 predicted 438
7 SASI_Hs01_00180031 predicted 1530
8 SASI_Hs01_00180032 predicted 1956
9 SASI_Hs01_00180033 predicted 1586
10 SASI_Hs01_00180034 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063300 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306570 predicted 1043
2 SASI_Rn02_00306571 predicted 388
3 SASI_Rn02_00306572 predicted 446
4 SASI_Rn02_00306573 predicted 1167
5 SASI_Rn02_00306574 predicted 1009
6 SASI_Rn02_00306575 predicted 653
7 SASI_Rn02_00306576 predicted 862
8 SASI_Rn02_00306577 predicted 694
9 SASI_Rn02_00306578 predicted 1050
10 SASI_Rn02_00306579 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404047 predicted 982
2 SASI_Rn02_00404048 predicted 326
3 SASI_Rn02_00404049 predicted 387
4 SASI_Rn02_00404050 predicted 1111
5 SASI_Rn02_00404051 predicted 946
6 SASI_Rn02_00404052 predicted 594
7 SASI_Rn02_00404053 predicted 802
8 SASI_Rn02_00404054 predicted 632
9 SASI_Rn02_00404055 predicted 991
10 SASI_Rn02_00404056 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425852 predicted 857
2 SASI_Mm02_00425853 predicted 923
3 SASI_Mm02_00425854 predicted 857
4 SASI_Mm02_00425855 predicted 917
5 SASI_Mm02_00425856 predicted 922
6 SASI_Mm02_00425857 predicted 922
7 SASI_Mm02_00425858 predicted 842
8 SASI_Mm02_00425859 predicted 852
9 SASI_Mm02_00425860 predicted 1284
10 SASI_Mm02_00425861 predicted 1105
11 SASI_Mm01_00252730 predicted 1157
12 SASI_Mm01_00252731 predicted 1150
13 SASI_Mm01_00252732 predicted 1150
14 SASI_Mm01_00252733 predicted 1156
15 SASI_Mm01_00252734 predicted 1152
16 SASI_Mm01_00252735 predicted 1154
17 SASI_Mm01_00252736 predicted 1154
18 SASI_Mm01_00252737 predicted 1156
19 SASI_Mm01_00252738 predicted 1165
20 SASI_Mm01_00252739 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441333 predicted 395
2 SASI_Mm02_00441334 predicted 1111
3 SASI_Mm02_00441335 predicted 518
4 SASI_Mm02_00441336 predicted 965
5 SASI_Mm02_00441337 predicted 1038
6 SASI_Mm02_00441338 predicted 481
7 SASI_Mm02_00441339 predicted 362
8 SASI_Mm02_00441340 predicted 846
9 SASI_Mm02_00441341 predicted 462
10 SASI_Mm02_00441342 predicted 492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020400
LPAR5 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidic acid receptor 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020400.3-1853s1c1
Sequence:CCGGGCCTAATACAAGAGTTCCTATCTCGAGATAGGAACTCTTGTATTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020400.3-526s1c1
Sequence:CCGGCGCCATCTTCCAGATGAACATCTCGAGATGTTCATCTGGAAGATGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020400.3-964s1c1
Sequence:CCGGGCTGTGCTTCGTGCCCTACAACTCGAGTTGTAGGGCACGAAGCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020400.3-748s1c1
Sequence:CCGGGCGCCTATGCTTCGAGAGCTTCTCGAGAAGCTCTCGAAGCATAGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020400.3-298s1c1
Sequence:CCGGCCGCCTGCACTTGGTGGTCTACTCGAGTAGACCACCAAGTGCAGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020400.5-610s21c1
Sequence:CCGGGTGAGCGTGTACATGTGTAACCTCGAGGTTACACATGTACACGCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020400.5-1684s21c1
Sequence:CCGGGCAACGCAGAAGAGTACAAAGCTCGAGCTTTGTACTCTTCTGCGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020400.5-2049s21c1
Sequence:CCGGGCTCACCACTGAGGCCTAATACTCGAGTATTAGGCCTCAGTGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020400.5-1319s21c1
Sequence:CCGGACCCGCTGGTGTACTACTTTACTCGAGTAAAGTAGTACACCAGCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020400
LPAR5 MISSION shRNA shRNA Plasmid DNA
lysophosphatidic acid receptor 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020400.3-1853s1c1
Sequence:CCGGGCCTAATACAAGAGTTCCTATCTCGAGATAGGAACTCTTGTATTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020400.3-526s1c1
Sequence:CCGGCGCCATCTTCCAGATGAACATCTCGAGATGTTCATCTGGAAGATGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020400.3-964s1c1
Sequence:CCGGGCTGTGCTTCGTGCCCTACAACTCGAGTTGTAGGGCACGAAGCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020400.3-748s1c1
Sequence:CCGGGCGCCTATGCTTCGAGAGCTTCTCGAGAAGCTCTCGAAGCATAGGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020400.3-298s1c1
Sequence:CCGGCCGCCTGCACTTGGTGGTCTACTCGAGTAGACCACCAAGTGCAGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020400.5-610s21c1
Sequence:CCGGGTGAGCGTGTACATGTGTAACCTCGAGGTTACACATGTACACGCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020400.5-1684s21c1
Sequence:CCGGGCAACGCAGAAGAGTACAAAGCTCGAGCTTTGTACTCTTCTGCGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020400.5-2049s21c1
Sequence:CCGGGCTCACCACTGAGGCCTAATACTCGAGTATTAGGCCTCAGTGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020400.5-1319s21c1
Sequence:CCGGACCCGCTGGTGTACTACTTTACTCGAGTAAAGTAGTACACCAGCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020400
LPAR5 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidic acid receptor 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020400.3-1853s1c1
Sequence:CCGGGCCTAATACAAGAGTTCCTATCTCGAGATAGGAACTCTTGTATTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020400.3-526s1c1
Sequence:CCGGCGCCATCTTCCAGATGAACATCTCGAGATGTTCATCTGGAAGATGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020400.3-964s1c1
Sequence:CCGGGCTGTGCTTCGTGCCCTACAACTCGAGTTGTAGGGCACGAAGCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020400.3-748s1c1
Sequence:CCGGGCGCCTATGCTTCGAGAGCTTCTCGAGAAGCTCTCGAAGCATAGGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020400.3-298s1c1
Sequence:CCGGCCGCCTGCACTTGGTGGTCTACTCGAGTAGACCACCAAGTGCAGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020400.5-610s21c1
Sequence:CCGGGTGAGCGTGTACATGTGTAACCTCGAGGTTACACATGTACACGCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020400.5-1684s21c1
Sequence:CCGGGCAACGCAGAAGAGTACAAAGCTCGAGCTTTGTACTCTTCTGCGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020400.5-2049s21c1
Sequence:CCGGGCTCACCACTGAGGCCTAATACTCGAGTATTAGGCCTCAGTGGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020400.5-1319s21c1
Sequence:CCGGACCCGCTGGTGTACTACTTTACTCGAGTAAAGTAGTACACCAGCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355812
LPAR5 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidic acid receptor 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355812.4-393s21c1
Sequence:CCGGGTGCCCTGACTATCGAGATACCTCGAGGTATCTCGATAGTCAGGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355812.4-1139s21c1
Sequence:GTACCGGACTTGGTGAAGAACAGTATTCCTCGAGGAATACTGTTCTTCACCAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355812.4-1221s21c1
Sequence:CCGGCGTGCTGGATCCACTGGTTTACTCGAGTAAACCAGTGGATCCAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355812.4-1083s21c1
Sequence:CCGGGCTGTGCTTCGTGCCCTATAACTCGAGTTATAGGGCACGAAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355812.4-932s21c1
Sequence:CCGGTGGCCGAGATACTAGGCTTTCCTCGAGGAAAGCCTAGTATCTCGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355812
LPAR5 MISSION shRNA shRNA Plasmid DNA
lysophosphatidic acid receptor 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355812.4-393s21c1
Sequence:CCGGGTGCCCTGACTATCGAGATACCTCGAGGTATCTCGATAGTCAGGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355812.4-1139s21c1
Sequence:GTACCGGACTTGGTGAAGAACAGTATTCCTCGAGGAATACTGTTCTTCACCAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355812.4-1221s21c1
Sequence:CCGGCGTGCTGGATCCACTGGTTTACTCGAGTAAACCAGTGGATCCAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355812.4-1083s21c1
Sequence:CCGGGCTGTGCTTCGTGCCCTATAACTCGAGTTATAGGGCACGAAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355812.4-932s21c1
Sequence:CCGGTGGCCGAGATACTAGGCTTTCCTCGAGGAAAGCCTAGTATCTCGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355812
LPAR5 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidic acid receptor 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355812.4-393s21c1
Sequence:CCGGGTGCCCTGACTATCGAGATACCTCGAGGTATCTCGATAGTCAGGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355812.4-1139s21c1
Sequence:GTACCGGACTTGGTGAAGAACAGTATTCCTCGAGGAATACTGTTCTTCACCAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355812.4-1221s21c1
Sequence:CCGGCGTGCTGGATCCACTGGTTTACTCGAGTAAACCAGTGGATCCAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355812.4-1083s21c1
Sequence:CCGGGCTGTGCTTCGTGCCCTATAACTCGAGTTATAGGGCACGAAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_355812.4-932s21c1
Sequence:CCGGTGGCCGAGATACTAGGCTTTCCTCGAGGAAAGCCTAGTATCTCGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)