EMAIL THIS PAGE TO A FRIEND

LPAR6

lysophosphatidic acid receptor 6

54 Gene Product Result for
Synonyms: ARWH1 LAH3 P2RY5 P2Y5
Gene ID:
Human(10161) Summary: The protein encoded by this gene belongs to the family of G-protein coupled receptors, that are preferentially activated by adenosine and uridine nucleotides. This gene aligns with an internal intron of the retinoblastoma susceptibility gene in the reverse orientation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
Mouse(67168) lysophosphatidic acid receptor 6
Rat(691774) lysophosphatidic acid receptor 6
chicken(396118) lysophosphatidic acid receptor 6
dog(100683989) lysophosphatidic acid receptor 6
domestic cat(101095629) lysophosphatidic acid receptor 6
cow(782518) lysophosphatidic acid receptor 6
naked mole-rat(101703338) lysophosphatidic acid receptor 6
domestic guinea pig(101787985) lysophosphatidic acid receptor 6
sheep(101114118) lysophosphatidic acid receptor 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P178 Pyridoxal phosphate-6-azo(benzene-2,4-disulfonic acid) tetrasodium salt hydrate solid, ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005767 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005767 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005767 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175116 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175116 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175116 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005767 Rosetta Predictions human pricing
NM_001045843 Rosetta Predictions rat pricing
NM_175116 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196631 predicted 1045
2 SASI_Hs01_00196632 predicted 823
3 SASI_Hs01_00196633 predicted 1043
4 SASI_Hs01_00196634 predicted 1655
5 SASI_Hs01_00196635 predicted 1604
6 SASI_Hs01_00196636 predicted 1775
7 SASI_Hs01_00196637 predicted 822
8 SASI_Hs01_00196638 predicted 1036
9 SASI_Hs01_00196639 predicted 1037
10 SASI_Hs01_00196640 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205764 predicted 750
2 SASI_Rn02_00205765 predicted 857
3 SASI_Rn02_00205766 predicted 740
4 SASI_Rn02_00205767 predicted 949
5 SASI_Rn02_00205768 predicted 685
6 SASI_Rn02_00205769 predicted 653
7 SASI_Rn02_00205770 predicted 1235
8 SASI_Rn02_00205771 predicted 636
9 SASI_Rn02_00205772 predicted 930
10 SASI_Rn02_00205773 predicted 1382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130142 predicted 1078
2 SASI_Mm01_00130143 predicted 727
3 SASI_Mm01_00130144 predicted 1310
4 SASI_Mm01_00130145 predicted 1585
5 SASI_Mm01_00130146 predicted 1055
6 SASI_Mm01_00130147 predicted 845
7 SASI_Mm01_00130148 predicted 749
8 SASI_Mm01_00130149 predicted 1475
9 SASI_Mm01_00130150 predicted 853
10 SASI_Mm01_00130151 predicted 1023
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005767
VALIDATED
LPAR6 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidic acid receptor 6
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.5-2485s21c1
Sequence:CCGGACCCTATAGTTTACTACTTTACTCGAGTAAAGTAGTAAACTATAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.4-836s21c1
Sequence:GTACCGGGACTCCTTTAAGTACACTTTGCTCGAGCAAAGTGTACTTAAAGGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005767.4-2014s21c1
Sequence:GTACCGGTGTATCCACTCCATCTGATTTCTCGAGAAATCAGATGGAGTGGATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.4-1024s21c1
Sequence:GTACCGGTTACTTCACAACACGGAATTGCTCGAGCAATTCCGTGTTGTGAAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.4-1146s21c1
Sequence:GTACCGGTGGCAATTGTCTACCCATTTACTCGAGTAAATGGGTAGACAATTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005767.5-2755s21c1
Sequence:CCGGGAAATTAACACATGGACATTTCTCGAGAAATGTCCATGTGTTAATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005767.3-945s1c1
Sequence:CCGGCCGAAATGAAACTACAACTTACTCGAGTAAGTTGTAGTTTCATTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.5-1705s21c1
Sequence:CCGGTGTTTGTGCTTGGGTTAATATCTCGAGATATTAACCCAAGCACAAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.4-929s21c1
Sequence:CCGGTGCGTCCTCAAAGTCCGAAATCTCGAGATTTCGGACTTTGAGGACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005767.3-1109s1c1
Sequence:CCGGGCATTCTGTTCTTAACCTGTACTCGAGTACAGGTTAAGAACAGAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005767.3-1861s1c1
Sequence:CCGGGACAGAACTTTCAAGTTCCTTCTCGAGAAGGAACTTGAAAGTTCTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005767.3-1674s1c1
Sequence:CCGGCTACTTTACATCGGACACAATCTCGAGATTGTGTCCGATGTAAAGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005767.3-1782s1c1
Sequence:CCGGGCATAACCTACAGACCTTAAACTCGAGTTTAAGGTCTGTAGGTTATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005767
VALIDATED
LPAR6 MISSION shRNA shRNA Plasmid DNA
lysophosphatidic acid receptor 6
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.5-2485s21c1
Sequence:CCGGACCCTATAGTTTACTACTTTACTCGAGTAAAGTAGTAAACTATAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.4-836s21c1
Sequence:GTACCGGGACTCCTTTAAGTACACTTTGCTCGAGCAAAGTGTACTTAAAGGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005767.4-2014s21c1
Sequence:GTACCGGTGTATCCACTCCATCTGATTTCTCGAGAAATCAGATGGAGTGGATACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.4-1024s21c1
Sequence:GTACCGGTTACTTCACAACACGGAATTGCTCGAGCAATTCCGTGTTGTGAAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.4-1146s21c1
Sequence:GTACCGGTGGCAATTGTCTACCCATTTACTCGAGTAAATGGGTAGACAATTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005767.5-2755s21c1
Sequence:CCGGGAAATTAACACATGGACATTTCTCGAGAAATGTCCATGTGTTAATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005767.3-945s1c1
Sequence:CCGGCCGAAATGAAACTACAACTTACTCGAGTAAGTTGTAGTTTCATTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.5-1705s21c1
Sequence:CCGGTGTTTGTGCTTGGGTTAATATCTCGAGATATTAACCCAAGCACAAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.4-929s21c1
Sequence:CCGGTGCGTCCTCAAAGTCCGAAATCTCGAGATTTCGGACTTTGAGGACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005767.3-1109s1c1
Sequence:CCGGGCATTCTGTTCTTAACCTGTACTCGAGTACAGGTTAAGAACAGAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005767.3-1861s1c1
Sequence:CCGGGACAGAACTTTCAAGTTCCTTCTCGAGAAGGAACTTGAAAGTTCTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005767.3-1674s1c1
Sequence:CCGGCTACTTTACATCGGACACAATCTCGAGATTGTGTCCGATGTAAAGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005767.3-1782s1c1
Sequence:CCGGGCATAACCTACAGACCTTAAACTCGAGTTTAAGGTCTGTAGGTTATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005767
VALIDATED
LPAR6 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidic acid receptor 6
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.5-2485s21c1
Sequence:CCGGACCCTATAGTTTACTACTTTACTCGAGTAAAGTAGTAAACTATAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.4-836s21c1
Sequence:GTACCGGGACTCCTTTAAGTACACTTTGCTCGAGCAAAGTGTACTTAAAGGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005767.4-2014s21c1
Sequence:GTACCGGTGTATCCACTCCATCTGATTTCTCGAGAAATCAGATGGAGTGGATACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.4-1024s21c1
Sequence:GTACCGGTTACTTCACAACACGGAATTGCTCGAGCAATTCCGTGTTGTGAAGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.4-1146s21c1
Sequence:GTACCGGTGGCAATTGTCTACCCATTTACTCGAGTAAATGGGTAGACAATTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005767.5-2755s21c1
Sequence:CCGGGAAATTAACACATGGACATTTCTCGAGAAATGTCCATGTGTTAATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005767.3-945s1c1
Sequence:CCGGCCGAAATGAAACTACAACTTACTCGAGTAAGTTGTAGTTTCATTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.5-1705s21c1
Sequence:CCGGTGTTTGTGCTTGGGTTAATATCTCGAGATATTAACCCAAGCACAAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005767.4-929s21c1
Sequence:CCGGTGCGTCCTCAAAGTCCGAAATCTCGAGATTTCGGACTTTGAGGACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005767.3-1109s1c1
Sequence:CCGGGCATTCTGTTCTTAACCTGTACTCGAGTACAGGTTAAGAACAGAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005767.3-1861s1c1
Sequence:CCGGGACAGAACTTTCAAGTTCCTTCTCGAGAAGGAACTTGAAAGTTCTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005767.3-1674s1c1
Sequence:CCGGCTACTTTACATCGGACACAATCTCGAGATTGTGTCCGATGTAAAGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005767.3-1782s1c1
Sequence:CCGGGCATAACCTACAGACCTTAAACTCGAGTTTAAGGTCTGTAGGTTATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175116
LPAR6 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidic acid receptor 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175116.2-868s1c1
Sequence:CCGGCGTACATGATTAACCTGGCAACTCGAGTTGCCAGGTTAATCATGTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175116.2-1082s1c1
Sequence:CCGGGACTTTAAGAACGAAACGAAACTCGAGTTTCGTTTCGTTCTTAAAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175116.2-840s1c1
Sequence:CCGGGCCCTCAAAGTGAGAAATGAACTCGAGTTCATTTCTCACTTTGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175116.2-1545s1c1
Sequence:CCGGGCTGTTTCCAACTGCTGCTTTCTCGAGAAAGCAGCAGTTGGAAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175116.2-1304s1c1
Sequence:CCGGGAACGTAACTTGTTCTAGTATCTCGAGATACTAGAACAAGTTACGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175116
LPAR6 MISSION shRNA shRNA Plasmid DNA
lysophosphatidic acid receptor 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175116.2-868s1c1
Sequence:CCGGCGTACATGATTAACCTGGCAACTCGAGTTGCCAGGTTAATCATGTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175116.2-1082s1c1
Sequence:CCGGGACTTTAAGAACGAAACGAAACTCGAGTTTCGTTTCGTTCTTAAAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175116.2-840s1c1
Sequence:CCGGGCCCTCAAAGTGAGAAATGAACTCGAGTTCATTTCTCACTTTGAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175116.2-1545s1c1
Sequence:CCGGGCTGTTTCCAACTGCTGCTTTCTCGAGAAAGCAGCAGTTGGAAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175116.2-1304s1c1
Sequence:CCGGGAACGTAACTTGTTCTAGTATCTCGAGATACTAGAACAAGTTACGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175116
LPAR6 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidic acid receptor 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175116.2-868s1c1
Sequence:CCGGCGTACATGATTAACCTGGCAACTCGAGTTGCCAGGTTAATCATGTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175116.2-1082s1c1
Sequence:CCGGGACTTTAAGAACGAAACGAAACTCGAGTTTCGTTTCGTTCTTAAAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175116.2-840s1c1
Sequence:CCGGGCCCTCAAAGTGAGAAATGAACTCGAGTTCATTTCTCACTTTGAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175116.2-1545s1c1
Sequence:CCGGGCTGTTTCCAACTGCTGCTTTCTCGAGAAAGCAGCAGTTGGAAACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175116.2-1304s1c1
Sequence:CCGGGAACGTAACTTGTTCTAGTATCTCGAGATACTAGAACAAGTTACGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)