EMAIL THIS PAGE TO A FRIEND

LPCAT1

lysophosphatidylcholine acyltransferase 1

72 Gene Product Result for
Synonyms: AYTL2 PFAAP3 lpcat
UniProtKB ID: Q8NF37, Q1HAQ1, Q7Z4G6, Q8N3U7, Q8WUL8, Q9GZW6
Gene ID:
Human(79888) Summary: Lysophosphatidylcholine (LPC) acyltransferase (LPCAT; EC 2.3.1.23) catalyzes the conversion of LPC to phosphatidylcholine (PC) in the remodeling pathway of PC biosynthesis (Nakanishi et al., 2006 [PubMed 16704971]
Mouse(210992) lysophosphatidylcholine acyltransferase 1
Rat(361467) lysophosphatidylcholine acyltransferase 1
Zebrafish(555969) lysophosphatidylcholine acyltransferase 1
cow(788450) lysophosphatidylcholine acyltransferase 1
dog(488066) lysophosphatidylcholine acyltransferase 1
domestic cat(101095078) lysophosphatidylcholine acyltransferase 1
chicken(420974) lysophosphatidylcholine acyltransferase 1
sheep(101111661) lysophosphatidylcholine acyltransferase 1
domestic guinea pig(100731890) lysophosphatidylcholine acyltransferase 1
naked mole-rat(101709594) lysophosphatidylcholine acyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024830 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145376 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145376 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145376 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024830 Rosetta Predictions human pricing
XM_001057012 Rosetta Predictions rat pricing
XM_001057066 Rosetta Predictions rat pricing
XM_341747 Rosetta Predictions rat pricing
NM_145376 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185781 predicted 1859
2 SASI_Hs02_00357392 predicted 902
3 SASI_Hs02_00357393 predicted 1596
4 SASI_Hs02_00357394 predicted 831
5 SASI_Hs01_00185782 predicted 1032
6 SASI_Hs01_00185783 predicted 600
7 SASI_Hs01_00185785 predicted 1778
8 SASI_Hs01_00185786 predicted 767
9 SASI_Hs01_00185787 predicted 1876
10 SASI_Hs02_00357395 predicted 1246
11 SASI_Hs01_00185779 predicted 705
12 SASI_Hs01_00185780 predicted 1260
13 SASI_Hs01_00185784 predicted 1874
14 SASI_Hs01_00185788 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285103 predicted 815
2 SASI_Rn02_00285104 predicted 1422
3 SASI_Rn02_00285105 predicted 812
4 SASI_Rn02_00285106 predicted 1152
5 SASI_Rn02_00285107 predicted 394
6 SASI_Rn02_00285108 predicted 542
7 SASI_Rn02_00285109 predicted 1219
8 SASI_Rn02_00285110 predicted 1007
9 SASI_Rn02_00285111 predicted 1621
10 SASI_Rn02_00285112 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057066 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285286 predicted 1018
2 SASI_Rn02_00285287 predicted 1615
3 SASI_Rn02_00285288 predicted 1014
4 SASI_Rn02_00285289 predicted 1351
5 SASI_Rn02_00285290 predicted 600
6 SASI_Rn02_00285291 predicted 744
7 SASI_Rn02_00285292 predicted 1415
8 SASI_Rn02_00285293 predicted 1206
9 SASI_Rn02_00285294 predicted 1821
10 SASI_Rn02_00285295 predicted 1481
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393300 predicted 1343
2 SASI_Rn02_00393301 predicted 1030
3 SASI_Rn02_00393302 predicted 1025
4 SASI_Rn02_00393303 predicted 1364
5 SASI_Rn02_00393304 predicted 602
6 SASI_Rn02_00393305 predicted 985
7 SASI_Rn02_00393306 predicted 745
8 SASI_Rn02_00393307 predicted 558
9 SASI_Rn02_00393308 predicted 1426
10 SASI_Rn02_00393309 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083165 predicted 1188
2 SASI_Mm02_00340666 predicted 620
3 SASI_Mm01_00083166 predicted 1200
4 SASI_Mm01_00083168 predicted 1182
5 SASI_Mm01_00083169 predicted 1146
6 SASI_Mm02_00340667 predicted 1191
7 SASI_Mm01_00083172 predicted 1053
8 SASI_Mm01_00083173 predicted 448
9 SASI_Mm01_00083174 predicted 591
10 SASI_Mm02_00340668 predicted 1266
11 SASI_Mm01_00083167 predicted 1631
12 SASI_Mm01_00083170 predicted 1703
13 SASI_Mm01_00083171 predicted 1830
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024830
VALIDATED
LPCAT1 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidylcholine acyltransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_024830.3-1595s1c1
Sequence:CCGGCGGATCAGACACATTTCGAAACTCGAGTTTCGAAATGTGTCTGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024830.3-618s1c1
Sequence:CCGGCCAGTATATACGGCCTGTGTTCTCGAGAACACAGGCCGTATATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_024830.3-1212s1c1
Sequence:CCGGGAAGATAGGTATTGCGGAGTTCTCGAGAACTCCGCAATACCTATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024830.3-513s1c1
Sequence:CCGGCGCGCCTCACTCGTCCTACTTCTCGAGAAGTAGGACGAGTGAGGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024830.3-1524s1c1
Sequence:CCGGGAAGATCACATTCGCTGACTTCTCGAGAAGTCAGCGAATGTGATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_024830.3-3709s21c1
Sequence:CCGGGACTTAGAGTTGGCGGATATTCTCGAGAATATCCGCCAACTCTAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024830.3-1591s21c1
Sequence:CCGGTACCCGGATCAGACACATTTCCTCGAGGAAATGTGTCTGATCCGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024830.3-1214s21c1
Sequence:CCGGAGATAGGTATTGCGGAGTTTGCTCGAGCAAACTCCGCAATACCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024830.3-707s21c1
Sequence:CCGGACGGAAAGTGGCCACAGATAACTCGAGTTATCTGTGGCCACTTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024830.3-607s21c1
Sequence:CCGGGGAACTCTGATCCAGTATATACTCGAGTATATACTGGATCAGAGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024830
VALIDATED
LPCAT1 MISSION shRNA shRNA Plasmid DNA
lysophosphatidylcholine acyltransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_024830.3-1595s1c1
Sequence:CCGGCGGATCAGACACATTTCGAAACTCGAGTTTCGAAATGTGTCTGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024830.3-618s1c1
Sequence:CCGGCCAGTATATACGGCCTGTGTTCTCGAGAACACAGGCCGTATATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_024830.3-1212s1c1
Sequence:CCGGGAAGATAGGTATTGCGGAGTTCTCGAGAACTCCGCAATACCTATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024830.3-513s1c1
Sequence:CCGGCGCGCCTCACTCGTCCTACTTCTCGAGAAGTAGGACGAGTGAGGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024830.3-1524s1c1
Sequence:CCGGGAAGATCACATTCGCTGACTTCTCGAGAAGTCAGCGAATGTGATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_024830.3-3709s21c1
Sequence:CCGGGACTTAGAGTTGGCGGATATTCTCGAGAATATCCGCCAACTCTAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024830.3-1591s21c1
Sequence:CCGGTACCCGGATCAGACACATTTCCTCGAGGAAATGTGTCTGATCCGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024830.3-1214s21c1
Sequence:CCGGAGATAGGTATTGCGGAGTTTGCTCGAGCAAACTCCGCAATACCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024830.3-707s21c1
Sequence:CCGGACGGAAAGTGGCCACAGATAACTCGAGTTATCTGTGGCCACTTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024830.3-607s21c1
Sequence:CCGGGGAACTCTGATCCAGTATATACTCGAGTATATACTGGATCAGAGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024830
VALIDATED
LPCAT1 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidylcholine acyltransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_024830.3-1595s1c1
Sequence:CCGGCGGATCAGACACATTTCGAAACTCGAGTTTCGAAATGTGTCTGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024830.3-618s1c1
Sequence:CCGGCCAGTATATACGGCCTGTGTTCTCGAGAACACAGGCCGTATATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_024830.3-1212s1c1
Sequence:CCGGGAAGATAGGTATTGCGGAGTTCTCGAGAACTCCGCAATACCTATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024830.3-513s1c1
Sequence:CCGGCGCGCCTCACTCGTCCTACTTCTCGAGAAGTAGGACGAGTGAGGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024830.3-1524s1c1
Sequence:CCGGGAAGATCACATTCGCTGACTTCTCGAGAAGTCAGCGAATGTGATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_024830.3-3709s21c1
Sequence:CCGGGACTTAGAGTTGGCGGATATTCTCGAGAATATCCGCCAACTCTAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024830.3-1591s21c1
Sequence:CCGGTACCCGGATCAGACACATTTCCTCGAGGAAATGTGTCTGATCCGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_024830.3-1214s21c1
Sequence:CCGGAGATAGGTATTGCGGAGTTTGCTCGAGCAAACTCCGCAATACCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_024830.3-707s21c1
Sequence:CCGGACGGAAAGTGGCCACAGATAACTCGAGTTATCTGTGGCCACTTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024830.3-607s21c1
Sequence:CCGGGGAACTCTGATCCAGTATATACTCGAGTATATACTGGATCAGAGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145376
LPCAT1 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidylcholine acyltransferase 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145376.3-1350s1c1
Sequence:CCGGGAGATTGACCTTCGTGAATATCTCGAGATATTCACGAAGGTCAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145376.3-863s1c1
Sequence:CCGGGCTACGCTACCCAAACAAATTCTCGAGAATTTGTTTGGGTAGCGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145376.3-2542s1c1
Sequence:CCGGCCTTCTTGAATCTCCATCTTTCTCGAGAAAGATGGAGATTCAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145376.3-1620s1c1
Sequence:CCGGGAGGACTACTTGTACCCTGATCTCGAGATCAGGGTACAAGTAGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145376.5-983s21c1
Sequence:CCGGACACCTGCCTGCTAGAGTTTGCTCGAGCAAACTCTAGCAGGCAGGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145376.5-621s21c1
Sequence:CCGGAGAAGGAACTTGTACAAATAGCTCGAGCTATTTGTACAAGTTCCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145376.5-1344s21c1
Sequence:CCGGACTGGGTGTATCAGAATTAACCTCGAGGTTAATTCTGATACACCCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145376
LPCAT1 MISSION shRNA shRNA Plasmid DNA
lysophosphatidylcholine acyltransferase 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145376.3-1350s1c1
Sequence:CCGGGAGATTGACCTTCGTGAATATCTCGAGATATTCACGAAGGTCAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145376.3-863s1c1
Sequence:CCGGGCTACGCTACCCAAACAAATTCTCGAGAATTTGTTTGGGTAGCGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145376.3-2542s1c1
Sequence:CCGGCCTTCTTGAATCTCCATCTTTCTCGAGAAAGATGGAGATTCAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145376.3-1620s1c1
Sequence:CCGGGAGGACTACTTGTACCCTGATCTCGAGATCAGGGTACAAGTAGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145376.5-983s21c1
Sequence:CCGGACACCTGCCTGCTAGAGTTTGCTCGAGCAAACTCTAGCAGGCAGGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145376.5-621s21c1
Sequence:CCGGAGAAGGAACTTGTACAAATAGCTCGAGCTATTTGTACAAGTTCCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145376.5-1344s21c1
Sequence:CCGGACTGGGTGTATCAGAATTAACCTCGAGGTTAATTCTGATACACCCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145376
LPCAT1 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidylcholine acyltransferase 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145376.3-1350s1c1
Sequence:CCGGGAGATTGACCTTCGTGAATATCTCGAGATATTCACGAAGGTCAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145376.3-863s1c1
Sequence:CCGGGCTACGCTACCCAAACAAATTCTCGAGAATTTGTTTGGGTAGCGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145376.3-2542s1c1
Sequence:CCGGCCTTCTTGAATCTCCATCTTTCTCGAGAAAGATGGAGATTCAAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145376.3-1620s1c1
Sequence:CCGGGAGGACTACTTGTACCCTGATCTCGAGATCAGGGTACAAGTAGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145376.5-983s21c1
Sequence:CCGGACACCTGCCTGCTAGAGTTTGCTCGAGCAAACTCTAGCAGGCAGGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145376.5-621s21c1
Sequence:CCGGAGAAGGAACTTGTACAAATAGCTCGAGCTATTTGTACAAGTTCCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145376.5-1344s21c1
Sequence:CCGGACTGGGTGTATCAGAATTAACCTCGAGGTTAATTCTGATACACCCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)