EMAIL THIS PAGE TO A FRIEND

LPCAT2

lysophosphatidylcholine acyltransferase 2

44 Gene Product Result for
Synonyms: AYTL1 LysoPAFAT
UniProtKB ID: Q7L5N7, A3KBM1, Q6MZJ6, Q9NX23
Gene ID:
Human(54947) Summary: This gene encodes a member of the lysophospholipid acyltransferase family. The encoded enzyme may function in two ways: to catalyze the biosynthesis of platelet-activating factor (1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine) from 1-O-alkyl-sn-glycero-3-phosphocholine, and to catalyze the synthesis of glycerophospholipid precursors from arachidonyl-CoA and lysophosphatidylcholine. The encoded protein may function in membrane biogenesis and production of platelet-activating factor in inflammatory cells. The enzyme may localize to the endoplasmic reticulum and the Golgi. [provided by RefSeq, Feb 2009]
Mouse(270084) lysophosphatidylcholine acyltransferase 2
Rat(100359680) lysophosphatidylcholine acyltransferase 2
naked mole-rat(101696607) lysophosphatidylcholine acyltransferase 2
Domestic Rabbit(100341001) lysophosphatidylcholine acyltransferase 2
domestic guinea pig(100723304) lysophosphatidylcholine acyltransferase 2
sheep(101115816) lysophosphatidylcholine acyltransferase 2
Zebrafish(553683) lysophosphatidylcholine acyltransferase 2
cow(514646) lysophosphatidylcholine acyltransferase 2
Horse(100061308) lysophosphatidylcholine acyltransferase 2
domestic cat(101099093) lysophosphatidylcholine acyltransferase 2
dog(611330) lysophosphatidylcholine acyltransferase 2
chicken(415716) lysophosphatidylcholine acyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017839 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173014 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173014 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173014 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017839 Rosetta Predictions human pricing
NM_173014 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049945 predicted 1043
2 SASI_Hs01_00049946 predicted 1438
3 SASI_Hs02_00350720 predicted 1217
4 SASI_Hs01_00049948 predicted 932
5 SASI_Hs01_00049949 predicted 1270
6 SASI_Hs02_00350721 predicted 1605
7 SASI_Hs01_00049952 predicted 1140
8 SASI_Hs01_00049953 predicted 1102
9 SASI_Hs02_00350722 predicted 1235
10 SASI_Hs02_00350723 predicted 1336
11 SASI_Hs01_00049944 predicted 597
12 SASI_Hs01_00049947 predicted 344
13 SASI_Hs01_00049950 predicted 958
14 SASI_Hs01_00049951 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173014 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345073 predicted 1011
2 SASI_Mm01_00192728 predicted 1401
3 SASI_Mm01_00192729 predicted 1590
4 SASI_Mm01_00192730 predicted 1249
5 SASI_Mm01_00192731 predicted 1332
6 SASI_Mm01_00192732 predicted 1584
7 SASI_Mm01_00192733 predicted 1570
8 SASI_Mm01_00192734 predicted 390
9 SASI_Mm01_00192736 predicted 764
10 SASI_Mm01_00192737 predicted 1264
11 SASI_Mm01_00192735 predicted 315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017839
LPCAT2 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidylcholine acyltransferase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017839.4-1252s21c1
Sequence:CCGGGGATGGTGTTCGTAAGCATTTCTCGAGAAATGCTTACGAACACCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017839.4-1117s21c1
Sequence:CCGGAGCTCTGGGAATACCAGTAACCTCGAGGTTACTGGTATTCCCAGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017839.4-1088s21c1
Sequence:CCGGGCCAATAAAGTCCGGAATTTACTCGAGTAAATTCCGGACTTTATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017839.4-389s21c1
Sequence:CCGGGTCTTATTGGTTGCGTTAATTCTCGAGAATTAACGCAACCAATAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017839.1-589s1c1
Sequence:CCGGCCTTCTATGGTATCTCGAAATCTCGAGATTTCGAGATACCATAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017839.1-967s1c1
Sequence:CCGGCCAGTTCAAGTACCAAATGATCTCGAGATCATTTGGTACTTGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017839.1-1576s1c1
Sequence:CCGGGCCTTAAAGCATCCAGAATATCTCGAGATATTCTGGATGCTTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017839.1-1309s1c1
Sequence:CCGGGCACTCTTTGACAGGAACCATCTCGAGATGGTTCCTGTCAAAGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017839.1-846s1c1
Sequence:CCGGCCTCCTCAGATACCCAAACAACTCGAGTTGTTTGGGTATCTGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017839
LPCAT2 MISSION shRNA shRNA Plasmid DNA
lysophosphatidylcholine acyltransferase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017839.4-1252s21c1
Sequence:CCGGGGATGGTGTTCGTAAGCATTTCTCGAGAAATGCTTACGAACACCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017839.4-1117s21c1
Sequence:CCGGAGCTCTGGGAATACCAGTAACCTCGAGGTTACTGGTATTCCCAGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017839.4-1088s21c1
Sequence:CCGGGCCAATAAAGTCCGGAATTTACTCGAGTAAATTCCGGACTTTATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017839.4-389s21c1
Sequence:CCGGGTCTTATTGGTTGCGTTAATTCTCGAGAATTAACGCAACCAATAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017839.1-589s1c1
Sequence:CCGGCCTTCTATGGTATCTCGAAATCTCGAGATTTCGAGATACCATAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017839.1-967s1c1
Sequence:CCGGCCAGTTCAAGTACCAAATGATCTCGAGATCATTTGGTACTTGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017839.1-1576s1c1
Sequence:CCGGGCCTTAAAGCATCCAGAATATCTCGAGATATTCTGGATGCTTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017839.1-1309s1c1
Sequence:CCGGGCACTCTTTGACAGGAACCATCTCGAGATGGTTCCTGTCAAAGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017839.1-846s1c1
Sequence:CCGGCCTCCTCAGATACCCAAACAACTCGAGTTGTTTGGGTATCTGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017839
LPCAT2 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidylcholine acyltransferase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017839.4-1252s21c1
Sequence:CCGGGGATGGTGTTCGTAAGCATTTCTCGAGAAATGCTTACGAACACCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017839.4-1117s21c1
Sequence:CCGGAGCTCTGGGAATACCAGTAACCTCGAGGTTACTGGTATTCCCAGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017839.4-1088s21c1
Sequence:CCGGGCCAATAAAGTCCGGAATTTACTCGAGTAAATTCCGGACTTTATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017839.4-389s21c1
Sequence:CCGGGTCTTATTGGTTGCGTTAATTCTCGAGAATTAACGCAACCAATAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017839.1-589s1c1
Sequence:CCGGCCTTCTATGGTATCTCGAAATCTCGAGATTTCGAGATACCATAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017839.1-967s1c1
Sequence:CCGGCCAGTTCAAGTACCAAATGATCTCGAGATCATTTGGTACTTGAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017839.1-1576s1c1
Sequence:CCGGGCCTTAAAGCATCCAGAATATCTCGAGATATTCTGGATGCTTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017839.1-1309s1c1
Sequence:CCGGGCACTCTTTGACAGGAACCATCTCGAGATGGTTCCTGTCAAAGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017839.1-846s1c1
Sequence:CCGGCCTCCTCAGATACCCAAACAACTCGAGTTGTTTGGGTATCTGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173014
LPCAT2 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidylcholine acyltransferase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173014.1-1398s21c1
Sequence:CCGGGATCATCCAGGTGGCATTTAACTCGAGTTAAATGCCACCTGGATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173014.1-1246s21c1
Sequence:CCGGATCGAGGAGTTTGCGGAATACCTCGAGGTATTCCGCAAACTCCTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173014.1-1238s1c1
Sequence:CCGGGAATTGGAATCGAGGAGTTTGCTCGAGCAAACTCCTCGATTCCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173014.1-1668s21c1
Sequence:CCGGTCCCTCTGTTGCTAGTAATAACTCGAGTTATTACTAGCAACAGAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173014.1-2277s21c1
Sequence:CCGGTTTCGCACTCTCCATAGTATACTCGAGTATACTATGGAGAGTGCGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173014.1-545s21c1
Sequence:CCGGCCACGTTCTTCGACGGAATTGCTCGAGCAATTCCGTCGAAGAACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173014.1-2447s1c1
Sequence:CCGGCCCAATAAGCAAATCAGATTTCTCGAGAAATCTGATTTGCTTATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173014.1-1573s1c1
Sequence:CCGGGCCCTAAAGCACCCAGAATATCTCGAGATATTCTGGGTGCTTTAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173014.1-1669s1c1
Sequence:CCGGCCCTCTGTTGCTAGTAATAAACTCGAGTTTATTACTAGCAACAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173014
LPCAT2 MISSION shRNA shRNA Plasmid DNA
lysophosphatidylcholine acyltransferase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173014.1-1398s21c1
Sequence:CCGGGATCATCCAGGTGGCATTTAACTCGAGTTAAATGCCACCTGGATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173014.1-1246s21c1
Sequence:CCGGATCGAGGAGTTTGCGGAATACCTCGAGGTATTCCGCAAACTCCTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173014.1-1238s1c1
Sequence:CCGGGAATTGGAATCGAGGAGTTTGCTCGAGCAAACTCCTCGATTCCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173014.1-1668s21c1
Sequence:CCGGTCCCTCTGTTGCTAGTAATAACTCGAGTTATTACTAGCAACAGAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173014.1-2277s21c1
Sequence:CCGGTTTCGCACTCTCCATAGTATACTCGAGTATACTATGGAGAGTGCGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173014.1-545s21c1
Sequence:CCGGCCACGTTCTTCGACGGAATTGCTCGAGCAATTCCGTCGAAGAACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173014.1-2447s1c1
Sequence:CCGGCCCAATAAGCAAATCAGATTTCTCGAGAAATCTGATTTGCTTATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173014.1-1573s1c1
Sequence:CCGGGCCCTAAAGCACCCAGAATATCTCGAGATATTCTGGGTGCTTTAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173014.1-1669s1c1
Sequence:CCGGCCCTCTGTTGCTAGTAATAAACTCGAGTTTATTACTAGCAACAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173014
LPCAT2 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidylcholine acyltransferase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173014.1-1398s21c1
Sequence:CCGGGATCATCCAGGTGGCATTTAACTCGAGTTAAATGCCACCTGGATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173014.1-1246s21c1
Sequence:CCGGATCGAGGAGTTTGCGGAATACCTCGAGGTATTCCGCAAACTCCTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173014.1-1238s1c1
Sequence:CCGGGAATTGGAATCGAGGAGTTTGCTCGAGCAAACTCCTCGATTCCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173014.1-1668s21c1
Sequence:CCGGTCCCTCTGTTGCTAGTAATAACTCGAGTTATTACTAGCAACAGAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173014.1-2277s21c1
Sequence:CCGGTTTCGCACTCTCCATAGTATACTCGAGTATACTATGGAGAGTGCGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173014.1-545s21c1
Sequence:CCGGCCACGTTCTTCGACGGAATTGCTCGAGCAATTCCGTCGAAGAACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173014.1-2447s1c1
Sequence:CCGGCCCAATAAGCAAATCAGATTTCTCGAGAAATCTGATTTGCTTATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173014.1-1573s1c1
Sequence:CCGGGCCCTAAAGCACCCAGAATATCTCGAGATATTCTGGGTGCTTTAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173014.1-1669s1c1
Sequence:CCGGCCCTCTGTTGCTAGTAATAAACTCGAGTTTATTACTAGCAACAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)