EMAIL THIS PAGE TO A FRIEND

LPCAT3

lysophosphatidylcholine acyltransferase 3

67 Gene Product Result for
Synonyms: C3F LPCAT LPLAT 5 LPSAT MBOAT5 OACT5 nessy
UniProtKB ID: Q6P1A2, B2RDH0, Q7KZS1, Q92980, Q9BW40
Gene ID:
Mouse(14792) lysophosphatidylcholine acyltransferase 3
Rat(362434) lysophosphatidylcholine acyltransferase 3
Zebrafish(555566) lysophosphatidylcholine acyltransferase 3
chicken(418293) lysophosphatidylcholine acyltransferase 3
dog(486715) lysophosphatidylcholine acyltransferase 3
cow(515361) lysophosphatidylcholine acyltransferase 3
Horse(100053035) lysophosphatidylcholine acyltransferase 3
domestic cat(101088419) lysophosphatidylcholine acyltransferase 3
domestic guinea pig(100722595) lysophosphatidylcholine acyltransferase 3
naked mole-rat(101696621) lysophosphatidylcholine acyltransferase 3
sheep(101108119) lysophosphatidylcholine acyltransferase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005768 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005768 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005768 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145130 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145130 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145130 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005768 Rosetta Predictions human pricing
NM_001012189 Rosetta Predictions rat pricing
XM_578393 Rosetta Predictions rat pricing
NM_145130 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005768 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167155 predicted 980
2 SASI_Hs01_00167156 predicted 553
3 SASI_Hs01_00167157 predicted 582
4 SASI_Hs01_00167158 predicted 1263
5 SASI_Hs01_00167161 predicted 1448
6 SASI_Hs01_00167162 predicted 1361
7 SASI_Hs01_00167163 predicted 1445
8 SASI_Hs01_00167164 predicted 600
9 SASI_Hs02_00340245 predicted 710
10 SASI_Hs02_00340246 predicted 531
11 SASI_Hs01_00167159 predicted 1526
12 SASI_Hs01_00167160 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012189 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091121 predicted 497
2 SASI_Rn01_00091122 predicted 515
3 SASI_Rn02_00200404 predicted 481
4 SASI_Rn01_00091125 predicted 1391
5 SASI_Rn01_00091126 predicted 1455
6 SASI_Rn01_00091127 predicted 1406
7 SASI_Rn02_00200405 predicted 842
8 SASI_Rn02_00200406 predicted 1099
9 SASI_Rn01_00091128 predicted 1175
10 SASI_Rn02_00200407 predicted 1353
11 SASI_Rn01_00091123 predicted 324
12 SASI_Rn01_00091124 predicted 1085
13 SASI_Rn01_00091129 predicted 337
14 SASI_Rn01_00091130 predicted 1556
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00137032 predicted 1293
2 SASI_Rn01_00137033 predicted 1316
3 SASI_Rn01_00137034 predicted 1951
4 SASI_Rn01_00137035 predicted 1911
5 SASI_Rn01_00137036 predicted 1267
6 SASI_Rn01_00137037 predicted 1306
7 SASI_Rn01_00137038 predicted 1362
8 SASI_Rn01_00137039 predicted 1995
9 SASI_Rn01_00137040 predicted 1922
10 SASI_Rn01_00137041 predicted 1961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340517 predicted 516
2 SASI_Mm01_00197994 predicted 1464
3 SASI_Mm01_00197995 predicted 441
4 SASI_Mm01_00197996 predicted 983
5 SASI_Mm01_00197997 predicted 1434
6 SASI_Mm01_00197998 predicted 1423
7 SASI_Mm01_00197999 predicted 1112
8 SASI_Mm01_00198001 predicted 525
9 SASI_Mm01_00198002 predicted 830
10 SASI_Mm01_00198003 predicted 1325
11 SASI_Mm01_00198000 predicted 1238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005768
VALIDATED
LPCAT3 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidylcholine acyltransferase 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_005768.5-396s1c1
Sequence:CCGGGCTGTGTATTGTGCTTCAGTTCTCGAGAACTGAAGCACAATACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005768.5-1505s1c1
Sequence:CCGGGCCTACTATTCATATTGCCTTCTCGAGAAGGCAATATGAATAGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005768.5-1158s1c1
Sequence:CCGGCATCTTCAAACGACTCAAGTTCTCGAGAACTTGAGTCGTTTGAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005768.5-2120s1c1
Sequence:CCGGCCCATCTAGCCAGGAATCTATCTCGAGATAGATTCCTGGCTAGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005768.5-1545s1c1
Sequence:CCGGGCCAAGGAAAGAGAAGTTAAACTCGAGTTTAACTTCTCTTTCCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005768.5-762s1c1
Sequence:CCGGGATTGACATACCAGGAAAGATCTCGAGATCTTTCCTGGTATGTCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005768.5-396s21c1
Sequence:CCGGGCTGTGTATTGTGCTTCAGTTCTCGAGAACTGAAGCACAATACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005768.5-1158s21c1
Sequence:CCGGCATCTTCAAACGACTCAAGTTCTCGAGAACTTGAGTCGTTTGAAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005768.5-1545s21c1
Sequence:CCGGGCCAAGGAAAGAGAAGTTAAACTCGAGTTTAACTTCTCTTTCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005768.5-1505s21c1
Sequence:CCGGGCCTACTATTCATATTGCCTTCTCGAGAAGGCAATATGAATAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005768.5-2120s21c1
Sequence:CCGGCCCATCTAGCCAGGAATCTATCTCGAGATAGATTCCTGGCTAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005768
VALIDATED
LPCAT3 MISSION shRNA shRNA Plasmid DNA
lysophosphatidylcholine acyltransferase 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_005768.5-396s1c1
Sequence:CCGGGCTGTGTATTGTGCTTCAGTTCTCGAGAACTGAAGCACAATACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005768.5-1505s1c1
Sequence:CCGGGCCTACTATTCATATTGCCTTCTCGAGAAGGCAATATGAATAGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005768.5-1158s1c1
Sequence:CCGGCATCTTCAAACGACTCAAGTTCTCGAGAACTTGAGTCGTTTGAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005768.5-2120s1c1
Sequence:CCGGCCCATCTAGCCAGGAATCTATCTCGAGATAGATTCCTGGCTAGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005768.5-1545s1c1
Sequence:CCGGGCCAAGGAAAGAGAAGTTAAACTCGAGTTTAACTTCTCTTTCCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005768.5-762s1c1
Sequence:CCGGGATTGACATACCAGGAAAGATCTCGAGATCTTTCCTGGTATGTCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005768.5-396s21c1
Sequence:CCGGGCTGTGTATTGTGCTTCAGTTCTCGAGAACTGAAGCACAATACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005768.5-1158s21c1
Sequence:CCGGCATCTTCAAACGACTCAAGTTCTCGAGAACTTGAGTCGTTTGAAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005768.5-1545s21c1
Sequence:CCGGGCCAAGGAAAGAGAAGTTAAACTCGAGTTTAACTTCTCTTTCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005768.5-1505s21c1
Sequence:CCGGGCCTACTATTCATATTGCCTTCTCGAGAAGGCAATATGAATAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005768.5-2120s21c1
Sequence:CCGGCCCATCTAGCCAGGAATCTATCTCGAGATAGATTCCTGGCTAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005768
VALIDATED
LPCAT3 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidylcholine acyltransferase 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_005768.5-396s1c1
Sequence:CCGGGCTGTGTATTGTGCTTCAGTTCTCGAGAACTGAAGCACAATACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005768.5-1505s1c1
Sequence:CCGGGCCTACTATTCATATTGCCTTCTCGAGAAGGCAATATGAATAGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005768.5-1158s1c1
Sequence:CCGGCATCTTCAAACGACTCAAGTTCTCGAGAACTTGAGTCGTTTGAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005768.5-2120s1c1
Sequence:CCGGCCCATCTAGCCAGGAATCTATCTCGAGATAGATTCCTGGCTAGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005768.5-1545s1c1
Sequence:CCGGGCCAAGGAAAGAGAAGTTAAACTCGAGTTTAACTTCTCTTTCCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005768.5-762s1c1
Sequence:CCGGGATTGACATACCAGGAAAGATCTCGAGATCTTTCCTGGTATGTCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005768.5-396s21c1
Sequence:CCGGGCTGTGTATTGTGCTTCAGTTCTCGAGAACTGAAGCACAATACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005768.5-1158s21c1
Sequence:CCGGCATCTTCAAACGACTCAAGTTCTCGAGAACTTGAGTCGTTTGAAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005768.5-1545s21c1
Sequence:CCGGGCCAAGGAAAGAGAAGTTAAACTCGAGTTTAACTTCTCTTTCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005768.5-1505s21c1
Sequence:CCGGGCCTACTATTCATATTGCCTTCTCGAGAAGGCAATATGAATAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005768.5-2120s21c1
Sequence:CCGGCCCATCTAGCCAGGAATCTATCTCGAGATAGATTCCTGGCTAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145130
VALIDATED
LPCAT3 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidylcholine acyltransferase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145130.1-1793s1c1
Sequence:CCGGGCCAATCTACTACGATTGTATCTCGAGATACAATCGTAGTAGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145130.1-1473s1c1
Sequence:CCGGCCTACTATTCATATTGCCTTACTCGAGTAAGGCAATATGAATAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145130.1-150s1c1
Sequence:CCGGCGAGGATCTGAGCCTTAACAACTCGAGTTGTTAAGGCTCAGATCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145130.1-416s1c1
Sequence:CCGGCTGCCGTTATTACTACCCTTTCTCGAGAAAGGGTAGTAATAACGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145130.1-1472s1c1
Sequence:CCGGGCCTACTATTCATATTGCCTTCTCGAGAAGGCAATATGAATAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145130
VALIDATED
LPCAT3 MISSION shRNA shRNA Plasmid DNA
lysophosphatidylcholine acyltransferase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145130.1-1793s1c1
Sequence:CCGGGCCAATCTACTACGATTGTATCTCGAGATACAATCGTAGTAGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145130.1-1473s1c1
Sequence:CCGGCCTACTATTCATATTGCCTTACTCGAGTAAGGCAATATGAATAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145130.1-150s1c1
Sequence:CCGGCGAGGATCTGAGCCTTAACAACTCGAGTTGTTAAGGCTCAGATCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145130.1-416s1c1
Sequence:CCGGCTGCCGTTATTACTACCCTTTCTCGAGAAAGGGTAGTAATAACGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145130.1-1472s1c1
Sequence:CCGGGCCTACTATTCATATTGCCTTCTCGAGAAGGCAATATGAATAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145130
VALIDATED
LPCAT3 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidylcholine acyltransferase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145130.1-1793s1c1
Sequence:CCGGGCCAATCTACTACGATTGTATCTCGAGATACAATCGTAGTAGATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145130.1-1473s1c1
Sequence:CCGGCCTACTATTCATATTGCCTTACTCGAGTAAGGCAATATGAATAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145130.1-150s1c1
Sequence:CCGGCGAGGATCTGAGCCTTAACAACTCGAGTTGTTAAGGCTCAGATCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145130.1-416s1c1
Sequence:CCGGCTGCCGTTATTACTACCCTTTCTCGAGAAAGGGTAGTAATAACGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145130.1-1472s1c1
Sequence:CCGGGCCTACTATTCATATTGCCTTCTCGAGAAGGCAATATGAATAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)