EMAIL THIS PAGE TO A FRIEND

LPCAT4

lysophosphatidylcholine acyltransferase 4

63 Gene Product Result for
Synonyms: AGPAT7 AYTL3 LPAAT-eta LPEAT2
UniProtKB ID: Q643R3, A8K2K8, O43412, Q7Z4P4, Q8IUL7, Q8TB38
Gene ID:
Human(254531) Summary: Members of the 1-acylglycerol-3-phosphate O-acyltransferase (EC 2.3.1.51) family, such as AGPAT7, catalyze the conversion of lysophosphatidic acid (LPA) to phosphatidic acid (PA), a precursor in the biosynthesis of all glycerolipids. Both LPA and PA are involved in signal transduction (Ye et al., 2005 [PubMed 16243729]
Mouse(99010) lysophosphatidylcholine acyltransferase 4
Rat(296048) lysophosphatidylcholine acyltransferase 4
sheep(101110515) lysophosphatidylcholine acyltransferase 4
naked mole-rat(101703809) lysophosphatidylcholine acyltransferase 4
domestic guinea pig(100727980) lysophosphatidylcholine acyltransferase 4
Zebrafish(327566) lysophosphatidylcholine acyltransferase 4
dog(478238) lysophosphatidylcholine acyltransferase 4
cow(510842) lysophosphatidylcholine acyltransferase 4
Horse(100071891) lysophosphatidylcholine acyltransferase 4
domestic cat(101090943) lysophosphatidylcholine acyltransferase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153613 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207206 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207206 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207206 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153613 Rosetta Predictions human pricing
NM_001106494 Rosetta Predictions rat pricing
NM_207206 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074023 predicted 936
2 SASI_Hs01_00074024 predicted 1329
3 SASI_Hs01_00074025 predicted 1241
4 SASI_Hs01_00074026 predicted 949
5 SASI_Hs01_00074027 predicted 514
6 SASI_Hs01_00074028 predicted 1034
7 SASI_Hs01_00074029 predicted 1146
8 SASI_Hs01_00074030 predicted 669
9 SASI_Hs01_00074031 predicted 545
10 SASI_Hs01_00074032 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106494 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219518 predicted 1255
2 SASI_Rn02_00219519 predicted 1315
3 SASI_Rn02_00219520 predicted 1044
4 SASI_Rn02_00219521 predicted 890
5 SASI_Rn02_00219522 predicted 1331
6 SASI_Rn02_00219523 predicted 722
7 SASI_Rn02_00219524 predicted 706
8 SASI_Rn02_00219525 predicted 1708
9 SASI_Rn02_00219526 predicted 1699
10 SASI_Rn02_00219527 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087056 predicted 952
2 SASI_Mm01_00087057 predicted 944
3 SASI_Mm01_00087058 predicted 673
4 SASI_Mm01_00087059 predicted 1166
5 SASI_Mm02_00351927 predicted 380
6 SASI_Mm01_00087060 predicted 348
7 SASI_Mm01_00087061 predicted 337
8 SASI_Mm01_00087062 predicted 516
9 SASI_Mm01_00087064 predicted 706
10 SASI_Mm01_00087065 predicted 302
11 SASI_Mm01_00087063 predicted 1340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153613
VALIDATED
LPCAT4 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidylcholine acyltransferase 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_153613.1-656s1c1
Sequence:CCGGGCCCTTCTTCGATTCAACCAACTCGAGTTGGTTGAATCGAAGAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153613.1-254s1c1
Sequence:CCGGGTGCATGAGTTACATCTCTCTCTCGAGAGAGAGATGTAACTCATGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_153613.1-1600s1c1
Sequence:CCGGCATGACCCACTCTATGGGAAACTCGAGTTTCCCATAGAGTGGGTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_153613.1-1035s1c1
Sequence:CCGGCAACAATGTTCAGAGGGTCATCTCGAGATGACCCTCTGAACATTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_153613.2-572s21c1
Sequence:CCGGGCCCTTCTTCGATTCAACCAACTCGAGTTGGTTGAATCGAAGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_153613.2-715s21c1
Sequence:CCGGCAACAAGAAGGCTTTGCTTAACTCGAGTTAAGCAAAGCCTTCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_153613.2-318s21c1
Sequence:CCGGAGCAGCTTCAGGAGCCAATTACTCGAGTAATTGGCTCCTGAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153613.1-792s1c1
Sequence:CCGGCTGTTCCAACAAGAAGGCTTTCTCGAGAAAGCCTTCTTGTTGGAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_153613.1-798s1c1
Sequence:CCGGCAACAAGAAGGCTTTGCTTAACTCGAGTTAAGCAAAGCCTTCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_153613.2-240s21c1
Sequence:CCGGTCCGAGTGCTTCTGGCCTTTACTCGAGTAAAGGCCAGAAGCACTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153613
VALIDATED
LPCAT4 MISSION shRNA shRNA Plasmid DNA
lysophosphatidylcholine acyltransferase 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_153613.1-656s1c1
Sequence:CCGGGCCCTTCTTCGATTCAACCAACTCGAGTTGGTTGAATCGAAGAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153613.1-254s1c1
Sequence:CCGGGTGCATGAGTTACATCTCTCTCTCGAGAGAGAGATGTAACTCATGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_153613.1-1600s1c1
Sequence:CCGGCATGACCCACTCTATGGGAAACTCGAGTTTCCCATAGAGTGGGTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_153613.1-1035s1c1
Sequence:CCGGCAACAATGTTCAGAGGGTCATCTCGAGATGACCCTCTGAACATTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_153613.2-572s21c1
Sequence:CCGGGCCCTTCTTCGATTCAACCAACTCGAGTTGGTTGAATCGAAGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_153613.2-715s21c1
Sequence:CCGGCAACAAGAAGGCTTTGCTTAACTCGAGTTAAGCAAAGCCTTCTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_153613.2-318s21c1
Sequence:CCGGAGCAGCTTCAGGAGCCAATTACTCGAGTAATTGGCTCCTGAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153613.1-792s1c1
Sequence:CCGGCTGTTCCAACAAGAAGGCTTTCTCGAGAAAGCCTTCTTGTTGGAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_153613.1-798s1c1
Sequence:CCGGCAACAAGAAGGCTTTGCTTAACTCGAGTTAAGCAAAGCCTTCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_153613.2-240s21c1
Sequence:CCGGTCCGAGTGCTTCTGGCCTTTACTCGAGTAAAGGCCAGAAGCACTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153613
VALIDATED
LPCAT4 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidylcholine acyltransferase 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_153613.1-656s1c1
Sequence:CCGGGCCCTTCTTCGATTCAACCAACTCGAGTTGGTTGAATCGAAGAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153613.1-254s1c1
Sequence:CCGGGTGCATGAGTTACATCTCTCTCTCGAGAGAGAGATGTAACTCATGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_153613.1-1600s1c1
Sequence:CCGGCATGACCCACTCTATGGGAAACTCGAGTTTCCCATAGAGTGGGTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_153613.1-1035s1c1
Sequence:CCGGCAACAATGTTCAGAGGGTCATCTCGAGATGACCCTCTGAACATTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_153613.2-572s21c1
Sequence:CCGGGCCCTTCTTCGATTCAACCAACTCGAGTTGGTTGAATCGAAGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_153613.2-715s21c1
Sequence:CCGGCAACAAGAAGGCTTTGCTTAACTCGAGTTAAGCAAAGCCTTCTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_153613.2-318s21c1
Sequence:CCGGAGCAGCTTCAGGAGCCAATTACTCGAGTAATTGGCTCCTGAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153613.1-792s1c1
Sequence:CCGGCTGTTCCAACAAGAAGGCTTTCTCGAGAAAGCCTTCTTGTTGGAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_153613.1-798s1c1
Sequence:CCGGCAACAAGAAGGCTTTGCTTAACTCGAGTTAAGCAAAGCCTTCTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_153613.2-240s21c1
Sequence:CCGGTCCGAGTGCTTCTGGCCTTTACTCGAGTAAAGGCCAGAAGCACTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207206
VALIDATED
LPCAT4 MISSION shRNA Bacterial Glycerol Stock
lysophosphatidylcholine acyltransferase 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207206.1-1004s1c1
Sequence:CCGGGCCACTGAATGTGAGTTTGTACTCGAGTACAAACTCACATTCAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207206.1-586s1c1
Sequence:CCGGCCTTCGATTTAATCAAGCCATCTCGAGATGGCTTGATTAAATCGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207206.1-742s1c1
Sequence:CCGGGAAGTTCAAACCAGGAGCCTTCTCGAGAAGGCTCCTGGTTTGAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207206.1-551s1c1
Sequence:CCGGGCTGAGAATCTTTCTGTGCCTCTCGAGAGGCACAGAAAGATTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207206.1-246s1c1
Sequence:CCGGCAATCCGAGTACTTCTAGCTTCTCGAGAAGCTAGAAGTACTCGGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207206.1-490s1c1
Sequence:CCGGCTCAACTTTCTTTGACCCAATCTCGAGATTGGGTCAAAGAAAGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207206.1-590s1c1
Sequence:CCGGCGATTTAATCAAGCCATCCTACTCGAGTAGGATGGCTTGATTAAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207206
VALIDATED
LPCAT4 MISSION shRNA shRNA Plasmid DNA
lysophosphatidylcholine acyltransferase 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207206.1-1004s1c1
Sequence:CCGGGCCACTGAATGTGAGTTTGTACTCGAGTACAAACTCACATTCAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207206.1-586s1c1
Sequence:CCGGCCTTCGATTTAATCAAGCCATCTCGAGATGGCTTGATTAAATCGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207206.1-742s1c1
Sequence:CCGGGAAGTTCAAACCAGGAGCCTTCTCGAGAAGGCTCCTGGTTTGAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207206.1-551s1c1
Sequence:CCGGGCTGAGAATCTTTCTGTGCCTCTCGAGAGGCACAGAAAGATTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207206.1-246s1c1
Sequence:CCGGCAATCCGAGTACTTCTAGCTTCTCGAGAAGCTAGAAGTACTCGGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207206.1-490s1c1
Sequence:CCGGCTCAACTTTCTTTGACCCAATCTCGAGATTGGGTCAAAGAAAGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207206.1-590s1c1
Sequence:CCGGCGATTTAATCAAGCCATCCTACTCGAGTAGGATGGCTTGATTAAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207206
VALIDATED
LPCAT4 MISSION shRNA Lentiviral Transduction Particles
lysophosphatidylcholine acyltransferase 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207206.1-1004s1c1
Sequence:CCGGGCCACTGAATGTGAGTTTGTACTCGAGTACAAACTCACATTCAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207206.1-586s1c1
Sequence:CCGGCCTTCGATTTAATCAAGCCATCTCGAGATGGCTTGATTAAATCGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207206.1-742s1c1
Sequence:CCGGGAAGTTCAAACCAGGAGCCTTCTCGAGAAGGCTCCTGGTTTGAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207206.1-551s1c1
Sequence:CCGGGCTGAGAATCTTTCTGTGCCTCTCGAGAGGCACAGAAAGATTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207206.1-246s1c1
Sequence:CCGGCAATCCGAGTACTTCTAGCTTCTCGAGAAGCTAGAAGTACTCGGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207206.1-490s1c1
Sequence:CCGGCTCAACTTTCTTTGACCCAATCTCGAGATTGGGTCAAAGAAAGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207206.1-590s1c1
Sequence:CCGGCGATTTAATCAAGCCATCCTACTCGAGTAGGATGGCTTGATTAAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)