EMAIL THIS PAGE TO A FRIEND

LPHN1

latrophilin 1

185 Gene Product Result for
Synonyms: CIRL1 CL1 LEC2
UniProtKB ID: O94910, Q96IE7, Q9BU07, Q9HAR3
Gene ID:
Human(22859) Summary: This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. Latrophilin-1 has been shown to recruit the neurotoxin from black widow spider venom, alpha-latrotoxin, to the synapse plasma membrane. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Oct 2008]
Mouse(330814) latrophilin 1
Rat(65096) latrophilin 1
domestic cat(101091175) latrophilin 1
cow(788252) latrophilin 1
dog(610349) latrophilin 1
sheep(101118356) latrophilin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014921 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181039 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181039 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181039 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008701 Rosetta Predictions human pricing
NM_014921 Rosetta Predictions human pricing
NM_022962 Rosetta Predictions rat pricing
NM_181039 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238685 predicted 2467
2 SASI_Hs01_00238687 predicted 982
3 SASI_Hs01_00238688 predicted 3699
4 SASI_Hs01_00238689 predicted 2169
5 SASI_Hs01_00238690 predicted 3779
6 SASI_Hs01_00238691 predicted 2517
7 SASI_Hs01_00238692 predicted 3140
8 SASI_Hs01_00238693 predicted 3164
9 SASI_Hs01_00238694 predicted 1333
10 SASI_Hs02_00305533 predicted 3529
11 SASI_Hs01_00238686 predicted 2124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033129 predicted 2450
2 SASI_Hs01_00033131 predicted 968
3 SASI_Hs01_00033132 predicted 3686
4 SASI_Hs01_00033133 predicted 4112
5 SASI_Hs01_00033134 predicted 2149
6 SASI_Hs01_00033135 predicted 3763
7 SASI_Hs01_00033136 predicted 2507
8 SASI_Hs01_00033137 predicted 3129
9 SASI_Hs01_00033138 predicted 3152
10 SASI_Hs02_00346568 predicted 1318
11 SASI_Hs01_00033130 predicted 2117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088352 predicted 1802
2 SASI_Rn01_00088353 predicted 2820
3 SASI_Rn01_00088354 predicted 1313
4 SASI_Rn01_00088355 predicted 1315
5 SASI_Rn01_00088356 predicted 4259
6 SASI_Rn01_00088357 predicted 3505
7 SASI_Rn01_00088358 predicted 3677
8 SASI_Rn01_00088359 predicted 2823
9 SASI_Rn02_00263701 predicted 2501
10 SASI_Rn01_00088360 predicted 2817
11 SASI_Rn01_00088361 predicted 1421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181039 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078173 predicted 4301
2 SASI_Mm01_00078175 predicted 3438
3 SASI_Mm02_00349593 predicted 4883
4 SASI_Mm01_00078177 predicted 3992
5 SASI_Mm01_00078180 predicted 4389
6 SASI_Mm02_00349594 predicted 4729
7 SASI_Mm01_00078181 predicted 2052
8 SASI_Mm01_00078182 predicted 4007
9 SASI_Mm02_00349595 predicted 1696
10 SASI_Mm02_00349596 predicted 1195
11 SASI_Mm01_00078174 predicted 1002
12 SASI_Mm01_00078176 predicted 1050
13 SASI_Mm01_00078178 predicted 696
14 SASI_Mm01_00078179 predicted 2851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014921
LPHN1 MISSION shRNA Bacterial Glycerol Stock
latrophilin 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014921.2-1405s1c1
Sequence:CCGGGCTGTACGTCTGGAACAACTACTCGAGTAGTTGTTCCAGACGTACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014921.2-5264s1c1
Sequence:CCGGGCTGGTGGTTTAAAGGTTGAACTCGAGTTCAACCTTTAAACCACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014921.2-4256s1c1
Sequence:CCGGGCCGAGATTGAACTTCTCTATCTCGAGATAGAGAAGTTCAATCTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014921.2-4000s1c1
Sequence:CCGGCGGCAACTTCAATAACAGTTACTCGAGTAACTGTTATTGAAGTTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014921.4-5202s21c1
Sequence:CCGGAGGTTCCTCCTGCGCTGTAATCTCGAGATTACAGCGCAGGAGGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014921.4-970s21c1
Sequence:CCGGCGCGCAACATCGTCAAGTATGCTCGAGCATACTTGACGATGTTGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014921.4-2110s21c1
Sequence:CCGGAGAGAACTTGTAAGGATTATACTCGAGTATAATCCTTACAAGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014921.4-3142s21c1
Sequence:CCGGAGGTGTTTGAGAGCGAGTATTCTCGAGAATACTCGCTCTCAAACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014921
LPHN1 MISSION shRNA shRNA Plasmid DNA
latrophilin 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014921.2-1405s1c1
Sequence:CCGGGCTGTACGTCTGGAACAACTACTCGAGTAGTTGTTCCAGACGTACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014921.2-5264s1c1
Sequence:CCGGGCTGGTGGTTTAAAGGTTGAACTCGAGTTCAACCTTTAAACCACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014921.2-4256s1c1
Sequence:CCGGGCCGAGATTGAACTTCTCTATCTCGAGATAGAGAAGTTCAATCTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014921.2-4000s1c1
Sequence:CCGGCGGCAACTTCAATAACAGTTACTCGAGTAACTGTTATTGAAGTTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014921.4-5202s21c1
Sequence:CCGGAGGTTCCTCCTGCGCTGTAATCTCGAGATTACAGCGCAGGAGGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014921.4-970s21c1
Sequence:CCGGCGCGCAACATCGTCAAGTATGCTCGAGCATACTTGACGATGTTGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014921.4-2110s21c1
Sequence:CCGGAGAGAACTTGTAAGGATTATACTCGAGTATAATCCTTACAAGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014921.4-3142s21c1
Sequence:CCGGAGGTGTTTGAGAGCGAGTATTCTCGAGAATACTCGCTCTCAAACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014921
LPHN1 MISSION shRNA Lentiviral Transduction Particles
latrophilin 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014921.2-1405s1c1
Sequence:CCGGGCTGTACGTCTGGAACAACTACTCGAGTAGTTGTTCCAGACGTACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014921.2-5264s1c1
Sequence:CCGGGCTGGTGGTTTAAAGGTTGAACTCGAGTTCAACCTTTAAACCACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014921.2-4256s1c1
Sequence:CCGGGCCGAGATTGAACTTCTCTATCTCGAGATAGAGAAGTTCAATCTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014921.2-4000s1c1
Sequence:CCGGCGGCAACTTCAATAACAGTTACTCGAGTAACTGTTATTGAAGTTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014921.4-5202s21c1
Sequence:CCGGAGGTTCCTCCTGCGCTGTAATCTCGAGATTACAGCGCAGGAGGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014921.4-970s21c1
Sequence:CCGGCGCGCAACATCGTCAAGTATGCTCGAGCATACTTGACGATGTTGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014921.4-2110s21c1
Sequence:CCGGAGAGAACTTGTAAGGATTATACTCGAGTATAATCCTTACAAGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014921.4-3142s21c1
Sequence:CCGGAGGTGTTTGAGAGCGAGTATTCTCGAGAATACTCGCTCTCAAACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181039
VALIDATED
LPHN1 MISSION shRNA Bacterial Glycerol Stock
latrophilin 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181039.2-3780s21c1
Sequence:CCGGATTCACGCACCAAGTACTATTCTCGAGAATAGTACTTGGTGCGTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181039.1-2201s1c1
Sequence:CCGGGCTTGAGTCATGGAAAGACATCTCGAGATGTCTTTCCATGACTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181039.2-6031s21c1
Sequence:CCGGCCCACTGGAGTGACCATATTTCTCGAGAAATATGGTCACTCCAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181039.2-3448s21c1
Sequence:CCGGGATCTACCAAGGCCGTATTAACTCGAGTTAATACGGCCTTGGTAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181039.2-1191s21c1
Sequence:CCGGTCATGTCACAGAGGTGTAATACTCGAGTATTACACCTCTGTGACATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181039.2-2632s1c1
Sequence:CCGGGATGGAACAACTGCTAGATATCTCGAGATATCTAGCAGTTGTTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181039.2-3202s21c1
Sequence:CCGGCATCGCAGCATCTATCAATAACTCGAGTTATTGATAGATGCTGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181039
VALIDATED
LPHN1 MISSION shRNA shRNA Plasmid DNA
latrophilin 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181039.2-3780s21c1
Sequence:CCGGATTCACGCACCAAGTACTATTCTCGAGAATAGTACTTGGTGCGTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181039.1-2201s1c1
Sequence:CCGGGCTTGAGTCATGGAAAGACATCTCGAGATGTCTTTCCATGACTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181039.2-6031s21c1
Sequence:CCGGCCCACTGGAGTGACCATATTTCTCGAGAAATATGGTCACTCCAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181039.2-3448s21c1
Sequence:CCGGGATCTACCAAGGCCGTATTAACTCGAGTTAATACGGCCTTGGTAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181039.2-1191s21c1
Sequence:CCGGTCATGTCACAGAGGTGTAATACTCGAGTATTACACCTCTGTGACATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181039.2-2632s1c1
Sequence:CCGGGATGGAACAACTGCTAGATATCTCGAGATATCTAGCAGTTGTTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181039.2-3202s21c1
Sequence:CCGGCATCGCAGCATCTATCAATAACTCGAGTTATTGATAGATGCTGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181039
VALIDATED
LPHN1 MISSION shRNA Lentiviral Transduction Particles
latrophilin 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181039.2-3780s21c1
Sequence:CCGGATTCACGCACCAAGTACTATTCTCGAGAATAGTACTTGGTGCGTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181039.1-2201s1c1
Sequence:CCGGGCTTGAGTCATGGAAAGACATCTCGAGATGTCTTTCCATGACTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242211    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181039.2-6031s21c1
Sequence:CCGGCCCACTGGAGTGACCATATTTCTCGAGAAATATGGTCACTCCAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181039.2-3448s21c1
Sequence:CCGGGATCTACCAAGGCCGTATTAACTCGAGTTAATACGGCCTTGGTAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181039.2-1191s21c1
Sequence:CCGGTCATGTCACAGAGGTGTAATACTCGAGTATTACACCTCTGTGACATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181039.2-2632s1c1
Sequence:CCGGGATGGAACAACTGCTAGATATCTCGAGATATCTAGCAGTTGTTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_181039.2-3202s21c1
Sequence:CCGGCATCGCAGCATCTATCAATAACTCGAGTTATTGATAGATGCTGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)