EMAIL THIS PAGE TO A FRIEND

LPHN2

latrophilin 2

233 Gene Product Result for
Synonyms: CIRL2 CL2 LEC1 LPHH1
Gene ID:
Human(23266) Summary: This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. While several transcript variants have been described, the biological validity of only one has been determined. [provided by RefSeq, Jul 2008]
Mouse(99633) latrophilin 2
Rat(171447) latrophilin 2
Zebrafish(100538279) latrophilin 2
domestic cat(101094116) latrophilin 2
cow(281278) latrophilin 2
Horse(100052932) latrophilin 2
dog(490193) latrophilin 2
chicken(424545) latrophilin 2
sheep(101104103) latrophilin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012302 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081298 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081298 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081298 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012302 Rosetta Predictions human pricing
NM_134408 Rosetta Predictions rat pricing
NM_001081298 Rosetta Predictions mouse pricing
XM_888040 Rosetta Predictions mouse pricing
XM_897704 Rosetta Predictions mouse pricing
XM_897716 Rosetta Predictions mouse pricing
XM_897725 Rosetta Predictions mouse pricing
XM_897770 Rosetta Predictions mouse pricing
XM_897790 Rosetta Predictions mouse pricing
XM_897800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230765 predicted 962
2 SASI_Hs01_00230766 predicted 1713
3 SASI_Hs01_00230767 predicted 2895
4 SASI_Hs01_00230768 predicted 3247
5 SASI_Hs01_00230769 predicted 1170
6 SASI_Hs02_00344074 predicted 3372
7 SASI_Hs01_00230770 predicted 4023
8 SASI_Hs01_00230771 predicted 639
9 SASI_Hs01_00230772 predicted 2263
10 SASI_Hs01_00230773 predicted 3789
11 SASI_Hs01_00230774 predicted 1323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134408 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098048 predicted 1828
2 SASI_Rn01_00098049 predicted 2408
3 SASI_Rn01_00098050 predicted 3106
4 SASI_Rn01_00098051 predicted 3779
5 SASI_Rn02_00268004 predicted 4023
6 SASI_Rn02_00268005 predicted 2199
7 SASI_Rn01_00098053 predicted 1055
8 SASI_Rn01_00098054 predicted 2174
9 SASI_Rn01_00098055 predicted 1855
10 SASI_Rn01_00098057 predicted 3595
11 SASI_Rn01_00098052 predicted 1165
12 SASI_Rn01_00098056 predicted 4037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297081 predicted 2811
2 SASI_Mm02_00297082 predicted 2633
3 SASI_Mm02_00297083 predicted 2334
4 SASI_Mm02_00297084 predicted 3588
5 SASI_Mm02_00297085 predicted 753
6 SASI_Mm02_00297086 predicted 4440
7 SASI_Mm02_00297087 predicted 428
8 SASI_Mm02_00297088 predicted 2916
9 SASI_Mm02_00297089 predicted 2656
10 SASI_Mm02_00297090 predicted 2200
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888040 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231411 predicted 4570
2 SASI_Mm01_00231412 predicted 4605
3 SASI_Mm01_00231413 predicted 4448
4 SASI_Mm01_00231414 predicted 3999
5 SASI_Mm01_00231415 predicted 4574
6 SASI_Mm01_00231416 predicted 4487
7 SASI_Mm01_00231417 predicted 4077
8 SASI_Mm01_00231418 predicted 3971
9 SASI_Mm01_00231419 predicted 3983
10 SASI_Mm01_00231420 predicted 4598
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219807 predicted 4312
2 SASI_Mm01_00219808 predicted 4362
3 SASI_Mm01_00219809 predicted 4200
4 SASI_Mm01_00219810 predicted 3748
5 SASI_Mm01_00219811 predicted 4330
6 SASI_Mm01_00219812 predicted 4240
7 SASI_Mm01_00219813 predicted 3828
8 SASI_Mm01_00219814 predicted 3712
9 SASI_Mm01_00219815 predicted 3729
10 SASI_Mm01_00219816 predicted 4353
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225545 predicted 1160
2 SASI_Mm01_00225546 predicted 1105
3 SASI_Mm01_00225547 predicted 1541
4 SASI_Mm01_00225548 predicted 1348
5 SASI_Mm01_00225549 predicted 1443
6 SASI_Mm01_00225550 predicted 1493
7 SASI_Mm01_00225551 predicted 1405
8 SASI_Mm01_00225552 predicted 1393
9 SASI_Mm01_00225553 predicted 1531
10 SASI_Mm01_00225554 predicted 1233
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249305 predicted 1817
2 SASI_Mm01_00249306 predicted 1857
3 SASI_Mm01_00249307 predicted 1699
4 SASI_Mm01_00249308 predicted 1255
5 SASI_Mm01_00249309 predicted 1830
6 SASI_Mm01_00249310 predicted 1746
7 SASI_Mm01_00249311 predicted 1325
8 SASI_Mm01_00249312 predicted 1223
9 SASI_Mm01_00249313 predicted 1240
10 SASI_Mm01_00249314 predicted 1850
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244479 predicted 939
2 SASI_Mm01_00244480 predicted 982
3 SASI_Mm01_00244481 predicted 815
4 SASI_Mm01_00244482 predicted 369
5 SASI_Mm01_00244483 predicted 943
6 SASI_Mm01_00244484 predicted 854
7 SASI_Mm01_00244485 predicted 447
8 SASI_Mm01_00244486 predicted 334
9 SASI_Mm01_00244487 predicted 354
10 SASI_Mm01_00244488 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206217 predicted 1813
2 SASI_Mm01_00206218 predicted 1857
3 SASI_Mm01_00206219 predicted 1699
4 SASI_Mm01_00206220 predicted 1247
5 SASI_Mm01_00206221 predicted 1830
6 SASI_Mm01_00206222 predicted 1741
7 SASI_Mm01_00206223 predicted 1328
8 SASI_Mm01_00206224 predicted 1217
9 SASI_Mm01_00206225 predicted 1230
10 SASI_Mm01_00206226 predicted 1855
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263214 predicted 2599
2 SASI_Mm01_00263215 predicted 2643
3 SASI_Mm01_00263216 predicted 2491
4 SASI_Mm01_00263217 predicted 2043
5 SASI_Mm01_00263218 predicted 2614
6 SASI_Mm01_00263219 predicted 2523
7 SASI_Mm01_00263220 predicted 2109
8 SASI_Mm01_00263221 predicted 2002
9 SASI_Mm01_00263222 predicted 2026
10 SASI_Mm01_00263223 predicted 2638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012302
LPHN2 MISSION shRNA Bacterial Glycerol Stock
latrophilin 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012302.2-3372s21c1
Sequence:CCGGGGCATATCTCTTCACTATATTCTCGAGAATATAGTGAAGAGATATGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012302.2-2896s21c1
Sequence:CCGGGCGATTGCATGCCCAATATTTCTCGAGAAATATTGGGCATGCAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012302.2-4330s21c1
Sequence:CCGGGGCAATAGTGATGGTTATATACTCGAGTATATAACCATCACTATTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012302.1-565s1c1
Sequence:CCGGCCTGGAACATACAAATACCTTCTCGAGAAGGTATTTGTATGTTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012302.1-2673s1c1
Sequence:CCGGCCACAGGGAAATTGCATATAACTCGAGTTATATGCAATTTCCCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012302.1-1253s1c1
Sequence:CCGGCCCGATTAAACCGAGGAGAATCTCGAGATTCTCCTCGGTTTAATCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012302.1-1843s1c1
Sequence:CCGGGCCAATGAACTGGCTAAACATCTCGAGATGTTTAGCCAGTTCATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012302.1-5247s1c1
Sequence:CCGGGCTTTGACAAAGTTAGTCTTTCTCGAGAAAGACTAACTTTGTCAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012302
LPHN2 MISSION shRNA shRNA Plasmid DNA
latrophilin 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012302.2-3372s21c1
Sequence:CCGGGGCATATCTCTTCACTATATTCTCGAGAATATAGTGAAGAGATATGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012302.2-2896s21c1
Sequence:CCGGGCGATTGCATGCCCAATATTTCTCGAGAAATATTGGGCATGCAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012302.2-4330s21c1
Sequence:CCGGGGCAATAGTGATGGTTATATACTCGAGTATATAACCATCACTATTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012302.1-565s1c1
Sequence:CCGGCCTGGAACATACAAATACCTTCTCGAGAAGGTATTTGTATGTTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012302.1-2673s1c1
Sequence:CCGGCCACAGGGAAATTGCATATAACTCGAGTTATATGCAATTTCCCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012302.1-1253s1c1
Sequence:CCGGCCCGATTAAACCGAGGAGAATCTCGAGATTCTCCTCGGTTTAATCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012302.1-1843s1c1
Sequence:CCGGGCCAATGAACTGGCTAAACATCTCGAGATGTTTAGCCAGTTCATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012302.1-5247s1c1
Sequence:CCGGGCTTTGACAAAGTTAGTCTTTCTCGAGAAAGACTAACTTTGTCAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012302
LPHN2 MISSION shRNA Lentiviral Transduction Particles
latrophilin 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012302.2-3372s21c1
Sequence:CCGGGGCATATCTCTTCACTATATTCTCGAGAATATAGTGAAGAGATATGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012302.2-2896s21c1
Sequence:CCGGGCGATTGCATGCCCAATATTTCTCGAGAAATATTGGGCATGCAATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012302.2-4330s21c1
Sequence:CCGGGGCAATAGTGATGGTTATATACTCGAGTATATAACCATCACTATTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012302.1-565s1c1
Sequence:CCGGCCTGGAACATACAAATACCTTCTCGAGAAGGTATTTGTATGTTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012302.1-2673s1c1
Sequence:CCGGCCACAGGGAAATTGCATATAACTCGAGTTATATGCAATTTCCCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012302.1-1253s1c1
Sequence:CCGGCCCGATTAAACCGAGGAGAATCTCGAGATTCTCCTCGGTTTAATCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012302.1-1843s1c1
Sequence:CCGGGCCAATGAACTGGCTAAACATCTCGAGATGTTTAGCCAGTTCATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012302.1-5247s1c1
Sequence:CCGGGCTTTGACAAAGTTAGTCTTTCTCGAGAAAGACTAACTTTGTCAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081298
VALIDATED
LPHN2 MISSION shRNA Bacterial Glycerol Stock
latrophilin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081298.1-822s21c1
Sequence:CCGGGAACGGCTTATGGGTCATTTACTCGAGTAAATGACCCATAAGCCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081298.1-116s21c1
Sequence:CCGGAGCTATCCTGTGAGGGTTATTCTCGAGAATAACCCTCACAGGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081298.1-4484s21c1
Sequence:CCGGCTAGGGCCACATGCAAGTATTCTCGAGAATACTTGCATGTGGCCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081298.1-544s21c1
Sequence:CCGGTACCGCACCGATACGTTAATACTCGAGTATTAACGTATCGGTGCGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081298.1-1087s21c1
Sequence:CCGGCCCAACCAGTACCAGTATATTCTCGAGAATATACTGGTACTGGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081298
VALIDATED
LPHN2 MISSION shRNA shRNA Plasmid DNA
latrophilin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081298.1-822s21c1
Sequence:CCGGGAACGGCTTATGGGTCATTTACTCGAGTAAATGACCCATAAGCCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081298.1-116s21c1
Sequence:CCGGAGCTATCCTGTGAGGGTTATTCTCGAGAATAACCCTCACAGGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081298.1-4484s21c1
Sequence:CCGGCTAGGGCCACATGCAAGTATTCTCGAGAATACTTGCATGTGGCCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081298.1-544s21c1
Sequence:CCGGTACCGCACCGATACGTTAATACTCGAGTATTAACGTATCGGTGCGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081298.1-1087s21c1
Sequence:CCGGCCCAACCAGTACCAGTATATTCTCGAGAATATACTGGTACTGGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081298
VALIDATED
LPHN2 MISSION shRNA Lentiviral Transduction Particles
latrophilin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081298.1-822s21c1
Sequence:CCGGGAACGGCTTATGGGTCATTTACTCGAGTAAATGACCCATAAGCCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081298.1-116s21c1
Sequence:CCGGAGCTATCCTGTGAGGGTTATTCTCGAGAATAACCCTCACAGGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081298.1-4484s21c1
Sequence:CCGGCTAGGGCCACATGCAAGTATTCTCGAGAATACTTGCATGTGGCCCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081298.1-544s21c1
Sequence:CCGGTACCGCACCGATACGTTAATACTCGAGTATTAACGTATCGGTGCGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081298.1-1087s21c1
Sequence:CCGGCCCAACCAGTACCAGTATATTCTCGAGAATATACTGGTACTGGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)