EMAIL THIS PAGE TO A FRIEND

LPHN3

latrophilin 3

184 Gene Product Result for
Synonyms: CIRL3 LEC3
UniProtKB ID: Q9HAR2, O94867, Q9NWK5
Gene ID:
Human(23284) Summary: This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. [provided by RefSeq, Jul 2008]
Mouse(319387) latrophilin 3
Rat(170641) latrophilin 3
chicken(422616) latrophilin 3
cow(282651) latrophilin 3
Horse(100056929) latrophilin 3
dog(482166) latrophilin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015236 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015236 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015236 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198702 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198702 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198702 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015236 Rosetta Predictions human pricing
NM_130822 Rosetta Predictions rat pricing
NM_198702 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114152 predicted 2423
2 SASI_Hs01_00114154 predicted 3588
3 SASI_Hs01_00114155 predicted 2480
4 SASI_Hs02_00347366 predicted 961
5 SASI_Hs02_00347367 predicted 3700
6 SASI_Hs01_00114156 predicted 267
7 SASI_Hs01_00114157 predicted 3752
8 SASI_Hs02_00347368 predicted 2074
9 SASI_Hs02_00347369 predicted 205
10 SASI_Hs01_00114158 predicted 2952
11 SASI_Hs01_00114153 predicted 2813
12 SASI_Hs01_00114159 predicted 3174
13 SASI_Hs01_00114160 predicted 3721
14 SASI_Hs01_00114161 predicted 1434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130822 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267516 predicted 3464
2 SASI_Rn02_00267517 predicted 1518
3 SASI_Rn01_00041277 predicted 4339
4 SASI_Rn01_00041278 predicted 269
5 SASI_Rn01_00041279 predicted 975
6 SASI_Rn01_00041280 predicted 3829
7 SASI_Rn01_00041281 predicted 3442
8 SASI_Rn01_00041282 predicted 3302
9 SASI_Rn01_00041283 predicted 4195
10 SASI_Rn01_00041284 predicted 4119
11 SASI_Rn01_00041285 predicted 2470
12 SASI_Rn01_00041286 predicted 3709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022835 predicted 1928
2 SASI_Mm02_00351155 predicted 4527
3 SASI_Mm01_00022837 predicted 2858
4 SASI_Mm01_00022838 predicted 4729
5 SASI_Mm01_00022839 predicted 2797
6 SASI_Mm01_00022840 predicted 3876
7 SASI_Mm01_00022842 predicted 3711
8 SASI_Mm02_00351156 predicted 4361
9 SASI_Mm01_00022844 predicted 3855
10 SASI_Mm02_00351157 predicted 4412
11 SASI_Mm01_00022836 predicted 3938
12 SASI_Mm01_00022841 predicted 4244
13 SASI_Mm01_00022843 predicted 3030
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015236
VALIDATED
LPHN3 MISSION shRNA Bacterial Glycerol Stock
latrophilin 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015236.4-2647s21c1
Sequence:CCGGAGCGTACAATGACAGGTTATTCTCGAGAATAACCTGTCATTGTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015236.4-498s21c1
Sequence:CCGGCCGTGTCCAGGAACCTATAAACTCGAGTTTATAGGTTCCTGGACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015236.4-1245s21c1
Sequence:CCGGCCTAATTCATACCAGTACATTCTCGAGAATGTACTGGTATGAATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015236.4-4630s21c1
Sequence:CCGGGACTGTTCTGAGTTGATATAACTCGAGTTATATCAACTCAGAACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015236.1-5675s1c1
Sequence:CCGGCCAGAATTTGAGTCCTGTTAACTCGAGTTAACAGGACTCAAATTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015236.1-2020s1c1
Sequence:CCGGCCCGAGAAATCATGTGGTTTACTCGAGTAAACCACATGATTTCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015236.1-1584s1c1
Sequence:CCGGCCTAATTCATACCAGTACATTCTCGAGAATGTACTGGTATGAATTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015236.1-2849s1c1
Sequence:CCGGCCCTGTTATTACGGCAGCAATCTCGAGATTGCTGCCGTAATAACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015236
VALIDATED
LPHN3 MISSION shRNA shRNA Plasmid DNA
latrophilin 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015236.4-2647s21c1
Sequence:CCGGAGCGTACAATGACAGGTTATTCTCGAGAATAACCTGTCATTGTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015236.4-498s21c1
Sequence:CCGGCCGTGTCCAGGAACCTATAAACTCGAGTTTATAGGTTCCTGGACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015236.4-1245s21c1
Sequence:CCGGCCTAATTCATACCAGTACATTCTCGAGAATGTACTGGTATGAATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015236.4-4630s21c1
Sequence:CCGGGACTGTTCTGAGTTGATATAACTCGAGTTATATCAACTCAGAACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015236.1-5675s1c1
Sequence:CCGGCCAGAATTTGAGTCCTGTTAACTCGAGTTAACAGGACTCAAATTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015236.1-2020s1c1
Sequence:CCGGCCCGAGAAATCATGTGGTTTACTCGAGTAAACCACATGATTTCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015236.1-1584s1c1
Sequence:CCGGCCTAATTCATACCAGTACATTCTCGAGAATGTACTGGTATGAATTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015236.1-2849s1c1
Sequence:CCGGCCCTGTTATTACGGCAGCAATCTCGAGATTGCTGCCGTAATAACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015236
VALIDATED
LPHN3 MISSION shRNA Lentiviral Transduction Particles
latrophilin 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015236.4-2647s21c1
Sequence:CCGGAGCGTACAATGACAGGTTATTCTCGAGAATAACCTGTCATTGTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015236.4-498s21c1
Sequence:CCGGCCGTGTCCAGGAACCTATAAACTCGAGTTTATAGGTTCCTGGACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015236.4-1245s21c1
Sequence:CCGGCCTAATTCATACCAGTACATTCTCGAGAATGTACTGGTATGAATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015236.4-4630s21c1
Sequence:CCGGGACTGTTCTGAGTTGATATAACTCGAGTTATATCAACTCAGAACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015236.1-5675s1c1
Sequence:CCGGCCAGAATTTGAGTCCTGTTAACTCGAGTTAACAGGACTCAAATTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015236.1-2020s1c1
Sequence:CCGGCCCGAGAAATCATGTGGTTTACTCGAGTAAACCACATGATTTCTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015236.1-1584s1c1
Sequence:CCGGCCTAATTCATACCAGTACATTCTCGAGAATGTACTGGTATGAATTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015236.1-2849s1c1
Sequence:CCGGCCCTGTTATTACGGCAGCAATCTCGAGATTGCTGCCGTAATAACAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198702
LPHN3 MISSION shRNA Bacterial Glycerol Stock
latrophilin 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000174678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198702.1-5539s1c1
Sequence:CCGGGCCAGAACTATTGTTTGAAATCTCGAGATTTCAAACAATAGTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198702.1-3112s1c1
Sequence:CCGGCCTGTGGTATTTACTGTTAAACTCGAGTTTAACAGTAAATACCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198702.1-1722s1c1
Sequence:CCGGCGGTAATAAGATTGACTACATCTCGAGATGTAGTCAATCTTATTACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198702.1-933s1c1
Sequence:CCGGGATGGAGAACATTCGGTGTTACTCGAGTAACACCGAATGTTCTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198702
LPHN3 MISSION shRNA shRNA Plasmid DNA
latrophilin 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000174678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198702.1-5539s1c1
Sequence:CCGGGCCAGAACTATTGTTTGAAATCTCGAGATTTCAAACAATAGTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198702.1-3112s1c1
Sequence:CCGGCCTGTGGTATTTACTGTTAAACTCGAGTTTAACAGTAAATACCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198702.1-1722s1c1
Sequence:CCGGCGGTAATAAGATTGACTACATCTCGAGATGTAGTCAATCTTATTACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198702.1-933s1c1
Sequence:CCGGGATGGAGAACATTCGGTGTTACTCGAGTAACACCGAATGTTCTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198702
LPHN3 MISSION shRNA Lentiviral Transduction Particles
latrophilin 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000174678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198702.1-5539s1c1
Sequence:CCGGGCCAGAACTATTGTTTGAAATCTCGAGATTTCAAACAATAGTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198702.1-3112s1c1
Sequence:CCGGCCTGTGGTATTTACTGTTAAACTCGAGTTTAACAGTAAATACCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198702.1-1722s1c1
Sequence:CCGGCGGTAATAAGATTGACTACATCTCGAGATGTAGTCAATCTTATTACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198702.1-933s1c1
Sequence:CCGGGATGGAGAACATTCGGTGTTACTCGAGTAACACCGAATGTTCTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)