EMAIL THIS PAGE TO A FRIEND

LPIN1

lipin 1

119 Gene Product Result for
Synonyms: PAP1
UniProtKB ID: Q14693, B7Z858, D6W506, Q53T25
Gene ID:
Human(23175) Summary: This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their full-length structures have not been determined. [provided by RefSeq, May 2012]
Mouse(14245) lipin 1
Rat(313977) lipin 1
dog(475670) lipin 1
cow(537224) lipin 1
chicken(421945) lipin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV53826 Anti-LPIN1 antibody produced in rabbit affinity isolated antibody rat, sheep, guinea pig, zebrafish, mouse, bovine, rabbit, human, pig, horse, canine
western blot pricing
HPA038021 Anti-LPIN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3501040 Anti-LPIN1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403125 Monoclonal Anti-LPIN1, (C-terminal) antibody produced in mouse clone 3D9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172950 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172950 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172950 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145693 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145693 Rosetta Predictions human pricing
NM_001012111 Rosetta Predictions rat pricing
XM_576006 Rosetta Predictions rat pricing
NM_001130412 Rosetta Predictions mouse pricing
NM_015763 Rosetta Predictions mouse pricing
NM_172950 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135007 predicted 1850
2 SASI_Hs01_00135008 predicted 2121
3 SASI_Hs01_00135009 predicted 1529
4 SASI_Hs02_00365299 predicted 335
5 SASI_Hs01_00135011 predicted 1680
6 SASI_Hs01_00135012 predicted 1740
7 SASI_Hs01_00135013 predicted 2778
8 SASI_Hs01_00135014 predicted 1132
9 SASI_Hs02_00365300 predicted 1921
10 SASI_Hs01_00135015 predicted 2578
11 SASI_Hs01_00135010 predicted 762
12 SASI_Hs01_00135016 predicted 2560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048475 predicted 798
2 SASI_Rn01_00048476 predicted 1790
3 SASI_Rn02_00200260 predicted 995
4 SASI_Rn01_00048478 predicted 865
5 SASI_Rn01_00048479 predicted 1859
6 SASI_Rn02_00200261 predicted 1375
7 SASI_Rn01_00048480 predicted 509
8 SASI_Rn01_00048481 predicted 2138
9 SASI_Rn01_00048482 predicted 1887
10 SASI_Rn01_00048483 predicted 2043
11 SASI_Rn01_00048477 predicted 1139
12 SASI_Rn01_00048484 predicted 2421
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122586 predicted 548
2 SASI_Rn01_00122587 predicted 1547
3 SASI_Rn01_00122588 predicted 888
4 SASI_Rn01_00122589 predicted 621
5 SASI_Rn01_00122590 predicted 1612
6 SASI_Rn01_00122591 predicted 253
7 SASI_Rn01_00122592 predicted 1894
8 SASI_Rn01_00122593 predicted 1637
9 SASI_Rn01_00122594 predicted 1794
10 SASI_Rn01_00122595 predicted 2173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311168 predicted 1633
2 SASI_Mm02_00311169 predicted 1394
3 SASI_Mm02_00311170 predicted 447
4 SASI_Mm02_00311171 predicted 1205
5 SASI_Mm02_00311172 predicted 2260
6 SASI_Mm02_00311173 predicted 431
7 SASI_Mm02_00311174 predicted 541
8 SASI_Mm02_00311175 predicted 2140
9 SASI_Mm02_00311176 predicted 1667
10 SASI_Mm02_00311177 predicted 1983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015763 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158726 predicted 1589
2 SASI_Mm01_00158727 predicted 1347
3 SASI_Mm02_00323094 predicted 297
4 SASI_Mm01_00158728 predicted 1157
5 SASI_Mm01_00158729 predicted 2212
6 SASI_Mm02_00323095 predicted 287
7 SASI_Mm01_00158730 predicted 398
8 SASI_Mm01_00158731 predicted 2091
9 SASI_Mm01_00158732 predicted 1624
10 SASI_Mm01_00158733 predicted 1934
11 SASI_Mm01_00158725 predicted 2253
12 SASI_Mm01_00158734 predicted 1724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191793 predicted 1488
2 SASI_Mm01_00191794 predicted 1245
3 SASI_Mm01_00191795 predicted 1055
4 SASI_Mm01_00191796 predicted 2120
5 SASI_Mm02_00344984 predicted 282
6 SASI_Mm01_00191797 predicted 397
7 SASI_Mm02_00344985 predicted 2389
8 SASI_Mm01_00191798 predicted 1994
9 SASI_Mm01_00191799 predicted 1529
10 SASI_Mm01_00191800 predicted 1832
11 SASI_Mm01_00191792 predicted 2199
12 SASI_Mm01_00191801 predicted 1677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172950
VALIDATED
LPIN1 MISSION shRNA Bacterial Glycerol Stock
lipin 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172950.2-3310s1c1
Sequence:CCGGGCTCTTTAATTGCTTTGGTTACTCGAGTAACCAAAGCAATTAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172950.2-2396s1c1
Sequence:CCGGCCAGTGTTTGACAGACATCAACTCGAGTTGATGTCTGTCAAACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172950.2-546s1c1
Sequence:CCGGGCCCAGTTGGACAATCTCAAACTCGAGTTTGAGATTGTCCAACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172950.2-1524s1c1
Sequence:CCGGGCCGTGTCATATCAGCAATTTCTCGAGAAATTGCTGATATGACACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172950.2-856s1c1
Sequence:CCGGCGCCAAAGAATAACCTGGAAACTCGAGTTTCCAGGTTATTCTTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172950.3-2396s21c1
Sequence:CCGGCCAGTGTTTGACAGACATCAACTCGAGTTGATGTCTGTCAAACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172950.3-1065s21c1
Sequence:CCGGAGTAAGGCCCAGACGGAAATGCTCGAGCATTTCCGTCTGGGCCTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172950.3-2734s21c1
Sequence:CCGGCTTGACGCGACCGAGCATTAACTCGAGTTAATGCTCGGTCGCGTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172950.3-2065s21c1
Sequence:CCGGTGTGGAATTGGGACGACAAAGCTCGAGCTTTGTCGTCCCAATTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172950.3-3310s21c1
Sequence:CCGGGCTCTTTAATTGCTTTGGTTACTCGAGTAACCAAAGCAATTAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172950
VALIDATED
LPIN1 MISSION shRNA shRNA Plasmid DNA
lipin 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172950.2-3310s1c1
Sequence:CCGGGCTCTTTAATTGCTTTGGTTACTCGAGTAACCAAAGCAATTAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172950.2-2396s1c1
Sequence:CCGGCCAGTGTTTGACAGACATCAACTCGAGTTGATGTCTGTCAAACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172950.2-546s1c1
Sequence:CCGGGCCCAGTTGGACAATCTCAAACTCGAGTTTGAGATTGTCCAACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172950.2-1524s1c1
Sequence:CCGGGCCGTGTCATATCAGCAATTTCTCGAGAAATTGCTGATATGACACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172950.2-856s1c1
Sequence:CCGGCGCCAAAGAATAACCTGGAAACTCGAGTTTCCAGGTTATTCTTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172950.3-2396s21c1
Sequence:CCGGCCAGTGTTTGACAGACATCAACTCGAGTTGATGTCTGTCAAACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172950.3-1065s21c1
Sequence:CCGGAGTAAGGCCCAGACGGAAATGCTCGAGCATTTCCGTCTGGGCCTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172950.3-2734s21c1
Sequence:CCGGCTTGACGCGACCGAGCATTAACTCGAGTTAATGCTCGGTCGCGTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172950.3-2065s21c1
Sequence:CCGGTGTGGAATTGGGACGACAAAGCTCGAGCTTTGTCGTCCCAATTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172950.3-3310s21c1
Sequence:CCGGGCTCTTTAATTGCTTTGGTTACTCGAGTAACCAAAGCAATTAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172950
VALIDATED
LPIN1 MISSION shRNA Lentiviral Transduction Particles
lipin 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172950.2-3310s1c1
Sequence:CCGGGCTCTTTAATTGCTTTGGTTACTCGAGTAACCAAAGCAATTAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172950.2-2396s1c1
Sequence:CCGGCCAGTGTTTGACAGACATCAACTCGAGTTGATGTCTGTCAAACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172950.2-546s1c1
Sequence:CCGGGCCCAGTTGGACAATCTCAAACTCGAGTTTGAGATTGTCCAACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172950.2-1524s1c1
Sequence:CCGGGCCGTGTCATATCAGCAATTTCTCGAGAAATTGCTGATATGACACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172950.2-856s1c1
Sequence:CCGGCGCCAAAGAATAACCTGGAAACTCGAGTTTCCAGGTTATTCTTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172950.3-2396s21c1
Sequence:CCGGCCAGTGTTTGACAGACATCAACTCGAGTTGATGTCTGTCAAACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172950.3-1065s21c1
Sequence:CCGGAGTAAGGCCCAGACGGAAATGCTCGAGCATTTCCGTCTGGGCCTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172950.3-2734s21c1
Sequence:CCGGCTTGACGCGACCGAGCATTAACTCGAGTTAATGCTCGGTCGCGTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172950.3-2065s21c1
Sequence:CCGGTGTGGAATTGGGACGACAAAGCTCGAGCTTTGTCGTCCCAATTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172950.3-3310s21c1
Sequence:CCGGGCTCTTTAATTGCTTTGGTTACTCGAGTAACCAAAGCAATTAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145693
LPIN1 MISSION shRNA Bacterial Glycerol Stock
lipin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145693.1-1650s1c1
Sequence:CCGGCCTTCCAGAAACCTTTGCCAACTCGAGTTGGCAAAGGTTTCTGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145693.1-660s1c1
Sequence:CCGGGCAGAACTCTTCCTAATGATACTCGAGTATCATTAGGAAGAGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145693.1-248s1c1
Sequence:CCGGCGAGAGAAAGTGGTTGACATACTCGAGTATGTCAACCACTTTCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145693.1-1842s1c1
Sequence:CCGGCCAGGGTAAAGCATGAATCATCTCGAGATGATTCATGCTTTACCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145693.1-1073s1c1
Sequence:CCGGCCTCAGACAGAAATGCAGTTTCTCGAGAAACTGCATTTCTGTCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145693.1-1839s1c1
Sequence:CCGGCCACCAGGGTAAAGCATGAATCTCGAGATTCATGCTTTACCCTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145693.1-2652s1c1
Sequence:CCGGCCTGTTCGGATACCTTCAGTACTCGAGTACTGAAGGTATCCGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145693.1-2721s21c1
Sequence:CCGGTTCATTCTGCCTCAGCGTAAACTCGAGTTTACGCTGAGGCAGAATGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145693.1-800s21c1
Sequence:CCGGTCCCGACCTTCAACACCTAAACTCGAGTTTAGGTGTTGAAGGTCGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145693.1-2180s21c1
Sequence:CCGGATCGCTAAGCTGTACCATAAACTCGAGTTTATGGTACAGCTTAGCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145693
LPIN1 MISSION shRNA shRNA Plasmid DNA
lipin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145693.1-1650s1c1
Sequence:CCGGCCTTCCAGAAACCTTTGCCAACTCGAGTTGGCAAAGGTTTCTGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145693.1-660s1c1
Sequence:CCGGGCAGAACTCTTCCTAATGATACTCGAGTATCATTAGGAAGAGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145693.1-248s1c1
Sequence:CCGGCGAGAGAAAGTGGTTGACATACTCGAGTATGTCAACCACTTTCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145693.1-1842s1c1
Sequence:CCGGCCAGGGTAAAGCATGAATCATCTCGAGATGATTCATGCTTTACCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145693.1-1073s1c1
Sequence:CCGGCCTCAGACAGAAATGCAGTTTCTCGAGAAACTGCATTTCTGTCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145693.1-1839s1c1
Sequence:CCGGCCACCAGGGTAAAGCATGAATCTCGAGATTCATGCTTTACCCTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145693.1-2652s1c1
Sequence:CCGGCCTGTTCGGATACCTTCAGTACTCGAGTACTGAAGGTATCCGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145693.1-2721s21c1
Sequence:CCGGTTCATTCTGCCTCAGCGTAAACTCGAGTTTACGCTGAGGCAGAATGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145693.1-800s21c1
Sequence:CCGGTCCCGACCTTCAACACCTAAACTCGAGTTTAGGTGTTGAAGGTCGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145693.1-2180s21c1
Sequence:CCGGATCGCTAAGCTGTACCATAAACTCGAGTTTATGGTACAGCTTAGCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145693
LPIN1 MISSION shRNA Lentiviral Transduction Particles
lipin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145693.1-1650s1c1
Sequence:CCGGCCTTCCAGAAACCTTTGCCAACTCGAGTTGGCAAAGGTTTCTGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145693.1-660s1c1
Sequence:CCGGGCAGAACTCTTCCTAATGATACTCGAGTATCATTAGGAAGAGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145693.1-248s1c1
Sequence:CCGGCGAGAGAAAGTGGTTGACATACTCGAGTATGTCAACCACTTTCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145693.1-1842s1c1
Sequence:CCGGCCAGGGTAAAGCATGAATCATCTCGAGATGATTCATGCTTTACCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145693.1-1073s1c1
Sequence:CCGGCCTCAGACAGAAATGCAGTTTCTCGAGAAACTGCATTTCTGTCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145693.1-1839s1c1
Sequence:CCGGCCACCAGGGTAAAGCATGAATCTCGAGATTCATGCTTTACCCTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145693.1-2652s1c1
Sequence:CCGGCCTGTTCGGATACCTTCAGTACTCGAGTACTGAAGGTATCCGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145693.1-2721s21c1
Sequence:CCGGTTCATTCTGCCTCAGCGTAAACTCGAGTTTACGCTGAGGCAGAATGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145693.1-800s21c1
Sequence:CCGGTCCCGACCTTCAACACCTAAACTCGAGTTTAGGTGTTGAAGGTCGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145693.1-2180s21c1
Sequence:CCGGATCGCTAAGCTGTACCATAAACTCGAGTTTATGGTACAGCTTAGCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)