EMAIL THIS PAGE TO A FRIEND

LPIN2

lipin 2

84 Gene Product Result for
UniProtKB ID: Q92539, A7MD25, D3DUH3
Gene ID:
Human(9663) Summary: Mouse studies suggest that this gene functions during normal adipose tissue development and may play a role in human triglyceride metabolism. This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. [provided by RefSeq, Jul 2008]
Mouse(64898) lipin 2
Rat(316737) lipin 2
chicken(421059) lipin 2
dog(607640) lipin 2
cow(514448) lipin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014646 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022882 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022882 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022882 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010371 MISSION® esiRNA esiRNA targeting human LPIN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014646 Rosetta Predictions human pricing
NM_001108236 Rosetta Predictions rat pricing
NM_022882 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059586 predicted 465
2 SASI_Hs01_00059587 predicted 2402
3 SASI_Hs01_00059588 predicted 1743
4 SASI_Hs01_00059590 predicted 1288
5 SASI_Hs01_00059591 predicted 320
6 SASI_Hs02_00345969 predicted 601
7 SASI_Hs01_00059592 predicted 357
8 SASI_Hs01_00059593 predicted 1165
9 SASI_Hs01_00059594 predicted 2922
10 SASI_Hs01_00059595 predicted 1855
11 SASI_Hs01_00059589 predicted 1645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236664 predicted 1212
2 SASI_Rn02_00236665 predicted 1619
3 SASI_Rn02_00236666 predicted 2577
4 SASI_Rn02_00236667 predicted 1916
5 SASI_Rn02_00236668 predicted 2265
6 SASI_Rn02_00236669 predicted 1096
7 SASI_Rn02_00236670 predicted 687
8 SASI_Rn02_00236671 predicted 410
9 SASI_Rn02_00236672 predicted 1004
10 SASI_Rn02_00236673 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326665 predicted 1138
2 SASI_Mm02_00326666 predicted 1686
3 SASI_Mm02_00326667 predicted 1253
4 SASI_Mm02_00326668 predicted 399
5 SASI_Mm02_00326669 predicted 2377
6 SASI_Mm02_00326670 predicted 546
7 SASI_Mm02_00326671 predicted 2702
8 SASI_Mm02_00326672 predicted 2177
9 SASI_Mm02_00326673 predicted 1271
10 SASI_Mm02_00326674 predicted 2442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014646
VALIDATED
LPIN2 MISSION shRNA Bacterial Glycerol Stock
lipin 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014646.2-1091s21c1
Sequence:CCGGTCCTAGGACAGCTACAATTACCTCGAGGTAATTGTAGCTGTCCTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014646.2-1714s21c1
Sequence:CCGGTCATTACTTATCACGAATTTGCTCGAGCAAATTCGTGATAAGTAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014646.2-952s21c1
Sequence:CCGGCAGCGTGTCCTAAGAGTGATTCTCGAGAATCACTCTTAGGACACGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014646.2-1437s21c1
Sequence:CCGGCCTGATGATATTTACCTTGATCTCGAGATCAAGGTAAATATCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014646.2-4480s21c1
Sequence:CCGGCCCTGACTGATTTCAGCCATTCTCGAGAATGGCTGAAATCAGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014646.2-952s1c1
Sequence:CCGGCAGCGTGTCCTAAGAGTGATTCTCGAGAATCACTCTTAGGACACGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162069    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014646.2-4481s1c1
Sequence:CCGGCCTGACTGATTTCAGCCATTTCTCGAGAAATGGCTGAAATCAGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014646.2-2383s1c1
Sequence:CCGGGTATAGCAAAGCTCTACCATTCTCGAGAATGGTAGAGCTTTGCTATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014646.2-1437s1c1
Sequence:CCGGCCTGATGATATTTACCTTGATCTCGAGATCAAGGTAAATATCATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014646.2-2216s1c1
Sequence:CCGGGTTTAGTATTACAACCCAGTACTCGAGTACTGGGTTGTAATACTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014646.2-4629s1c1
Sequence:CCGGCCCAGCTTAAATAGTTGATAACTCGAGTTATCAACTATTTAAGCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014646.2-2126s1c1
Sequence:CCGGCGGCAGCACAACTTCATATAACTCGAGTTATATGAAGTTGTGCTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014646.2-361s1c1
Sequence:CCGGGCAGCTATCAGTGTTCACCTTCTCGAGAAGGTGAACACTGATAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014646
VALIDATED
LPIN2 MISSION shRNA shRNA Plasmid DNA
lipin 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014646.2-1091s21c1
Sequence:CCGGTCCTAGGACAGCTACAATTACCTCGAGGTAATTGTAGCTGTCCTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014646.2-1714s21c1
Sequence:CCGGTCATTACTTATCACGAATTTGCTCGAGCAAATTCGTGATAAGTAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014646.2-952s21c1
Sequence:CCGGCAGCGTGTCCTAAGAGTGATTCTCGAGAATCACTCTTAGGACACGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014646.2-1437s21c1
Sequence:CCGGCCTGATGATATTTACCTTGATCTCGAGATCAAGGTAAATATCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014646.2-4480s21c1
Sequence:CCGGCCCTGACTGATTTCAGCCATTCTCGAGAATGGCTGAAATCAGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014646.2-952s1c1
Sequence:CCGGCAGCGTGTCCTAAGAGTGATTCTCGAGAATCACTCTTAGGACACGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162069    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014646.2-4481s1c1
Sequence:CCGGCCTGACTGATTTCAGCCATTTCTCGAGAAATGGCTGAAATCAGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014646.2-2383s1c1
Sequence:CCGGGTATAGCAAAGCTCTACCATTCTCGAGAATGGTAGAGCTTTGCTATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014646.2-1437s1c1
Sequence:CCGGCCTGATGATATTTACCTTGATCTCGAGATCAAGGTAAATATCATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014646.2-2216s1c1
Sequence:CCGGGTTTAGTATTACAACCCAGTACTCGAGTACTGGGTTGTAATACTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014646.2-4629s1c1
Sequence:CCGGCCCAGCTTAAATAGTTGATAACTCGAGTTATCAACTATTTAAGCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014646.2-2126s1c1
Sequence:CCGGCGGCAGCACAACTTCATATAACTCGAGTTATATGAAGTTGTGCTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014646.2-361s1c1
Sequence:CCGGGCAGCTATCAGTGTTCACCTTCTCGAGAAGGTGAACACTGATAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014646
VALIDATED
LPIN2 MISSION shRNA Lentiviral Transduction Particles
lipin 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014646.2-1091s21c1
Sequence:CCGGTCCTAGGACAGCTACAATTACCTCGAGGTAATTGTAGCTGTCCTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014646.2-1714s21c1
Sequence:CCGGTCATTACTTATCACGAATTTGCTCGAGCAAATTCGTGATAAGTAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014646.2-952s21c1
Sequence:CCGGCAGCGTGTCCTAAGAGTGATTCTCGAGAATCACTCTTAGGACACGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014646.2-1437s21c1
Sequence:CCGGCCTGATGATATTTACCTTGATCTCGAGATCAAGGTAAATATCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014646.2-4480s21c1
Sequence:CCGGCCCTGACTGATTTCAGCCATTCTCGAGAATGGCTGAAATCAGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014646.2-952s1c1
Sequence:CCGGCAGCGTGTCCTAAGAGTGATTCTCGAGAATCACTCTTAGGACACGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162069    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014646.2-4481s1c1
Sequence:CCGGCCTGACTGATTTCAGCCATTTCTCGAGAAATGGCTGAAATCAGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014646.2-2383s1c1
Sequence:CCGGGTATAGCAAAGCTCTACCATTCTCGAGAATGGTAGAGCTTTGCTATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014646.2-1437s1c1
Sequence:CCGGCCTGATGATATTTACCTTGATCTCGAGATCAAGGTAAATATCATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014646.2-2216s1c1
Sequence:CCGGGTTTAGTATTACAACCCAGTACTCGAGTACTGGGTTGTAATACTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160186    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014646.2-4629s1c1
Sequence:CCGGCCCAGCTTAAATAGTTGATAACTCGAGTTATCAACTATTTAAGCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014646.2-2126s1c1
Sequence:CCGGCGGCAGCACAACTTCATATAACTCGAGTTATATGAAGTTGTGCTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014646.2-361s1c1
Sequence:CCGGGCAGCTATCAGTGTTCACCTTCTCGAGAAGGTGAACACTGATAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022882
VALIDATED
LPIN2 MISSION shRNA Bacterial Glycerol Stock
lipin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022882.3-1459s21c1
Sequence:CCGGGCGGCTCTCTATTTCCCTAAACTCGAGTTTAGGGAAATAGAGAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022882.3-641s21c1
Sequence:CCGGCCTTGGAATCAGAGGCAGTTTCTCGAGAAACTGCCTCTGATTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022882.3-3783s21c1
Sequence:CCGGCCAACCATGTAATGCAGTCATCTCGAGATGACTGCATTACATGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022882.3-1739s21c1
Sequence:CCGGACCTCGTGATCCGGATATATACTCGAGTATATATCCGGATCACGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022882.3-1273s21c1
Sequence:CCGGGCACCTCAGATTTCATCGCTACTCGAGTAGCGATGAAATCTGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022882.2-3786s1c1
Sequence:CCGGCCAACCATGTAATGCAGTCATCTCGAGATGACTGCATTACATGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022882.2-644s1c1
Sequence:CCGGCCTTGGAATCAGAGGCAGTTTCTCGAGAAACTGCCTCTGATTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022882.2-1462s1c1
Sequence:CCGGGCGGCTCTCTATTTCCCTAAACTCGAGTTTAGGGAAATAGAGAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022882.2-1276s1c1
Sequence:CCGGGCACCTCAGATTTCATCGCTACTCGAGTAGCGATGAAATCTGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022882.2-1142s1c1
Sequence:CCGGGCCTCATAAGAGAAGTTGAAACTCGAGTTTCAACTTCTCTTATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022882
VALIDATED
LPIN2 MISSION shRNA shRNA Plasmid DNA
lipin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022882.3-1459s21c1
Sequence:CCGGGCGGCTCTCTATTTCCCTAAACTCGAGTTTAGGGAAATAGAGAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022882.3-641s21c1
Sequence:CCGGCCTTGGAATCAGAGGCAGTTTCTCGAGAAACTGCCTCTGATTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022882.3-3783s21c1
Sequence:CCGGCCAACCATGTAATGCAGTCATCTCGAGATGACTGCATTACATGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022882.3-1739s21c1
Sequence:CCGGACCTCGTGATCCGGATATATACTCGAGTATATATCCGGATCACGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022882.3-1273s21c1
Sequence:CCGGGCACCTCAGATTTCATCGCTACTCGAGTAGCGATGAAATCTGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022882.2-3786s1c1
Sequence:CCGGCCAACCATGTAATGCAGTCATCTCGAGATGACTGCATTACATGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022882.2-644s1c1
Sequence:CCGGCCTTGGAATCAGAGGCAGTTTCTCGAGAAACTGCCTCTGATTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022882.2-1462s1c1
Sequence:CCGGGCGGCTCTCTATTTCCCTAAACTCGAGTTTAGGGAAATAGAGAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022882.2-1276s1c1
Sequence:CCGGGCACCTCAGATTTCATCGCTACTCGAGTAGCGATGAAATCTGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022882.2-1142s1c1
Sequence:CCGGGCCTCATAAGAGAAGTTGAAACTCGAGTTTCAACTTCTCTTATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022882
VALIDATED
LPIN2 MISSION shRNA Lentiviral Transduction Particles
lipin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022882.3-1459s21c1
Sequence:CCGGGCGGCTCTCTATTTCCCTAAACTCGAGTTTAGGGAAATAGAGAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022882.3-641s21c1
Sequence:CCGGCCTTGGAATCAGAGGCAGTTTCTCGAGAAACTGCCTCTGATTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022882.3-3783s21c1
Sequence:CCGGCCAACCATGTAATGCAGTCATCTCGAGATGACTGCATTACATGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022882.3-1739s21c1
Sequence:CCGGACCTCGTGATCCGGATATATACTCGAGTATATATCCGGATCACGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022882.3-1273s21c1
Sequence:CCGGGCACCTCAGATTTCATCGCTACTCGAGTAGCGATGAAATCTGAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022882.2-3786s1c1
Sequence:CCGGCCAACCATGTAATGCAGTCATCTCGAGATGACTGCATTACATGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022882.2-644s1c1
Sequence:CCGGCCTTGGAATCAGAGGCAGTTTCTCGAGAAACTGCCTCTGATTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022882.2-1462s1c1
Sequence:CCGGGCGGCTCTCTATTTCCCTAAACTCGAGTTTAGGGAAATAGAGAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022882.2-1276s1c1
Sequence:CCGGGCACCTCAGATTTCATCGCTACTCGAGTAGCGATGAAATCTGAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022882.2-1142s1c1
Sequence:CCGGGCCTCATAAGAGAAGTTGAAACTCGAGTTTCAACTTCTCTTATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)