EMAIL THIS PAGE TO A FRIEND

LPIN3

lipin 3

51 Gene Product Result for
Synonyms: LIPN3L SMP2 dJ450M14.2 dJ450M14.3 dJ620E11.2
UniProtKB ID: Q9BQK8, B2RTT5, Q5TDB9, Q9NPY8, Q9UJE5
Gene ID:
Human(64900) Summary: Humans lipodystrophy is characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. Mice carrying mutations in the fatty liver dystrophy (fld) gene have similar phenotypes. Through positional cloning, the mouse gene responsible for fatty liver dystrophy was isolated and designated Lpin1. The nuclear protein encoded by Lpin1 was named lipin. Lpin1 mRNA was expressed at high levels in adipose tissue and was induced during differentiation of preadipocytes. These results indicated that lipin is required for normal adipose tissue development and provided a candidate gene for human lipodystrophy. Through database searches, mouse and human EST and genomic sequences with similarities to Lpin1 were identified. These included two related mouse genes (Lpin2 and Lpin3) and three human homologs (LPIN1, LPIN2, and LPIN3). Human LPIN1 gene has been mapped to 2p25.; linkages of fat mass and serum leptin levels to this same region have been noted. Human LPIN2 and LPIN3 mapped to chromosomes 18p11 and 20q11-q12, respectively. The mouse genes encoding Lpin1, Lpin2, and Lpin3 mapped to chromosome 12, 17, and 2, respectively. [provided by RefSeq, Jul 2008]
Mouse(64899) lipin 3
Rat(362261) lipin 3
cow(521637) lipin 3
dog(485876) lipin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022896 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143491 MISSION® esiRNA esiRNA human LPIN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022896 Rosetta Predictions human pricing
NM_001014184 Rosetta Predictions rat pricing
NM_022883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143270 predicted 2497
2 SASI_Hs01_00143271 predicted 2118
3 SASI_Hs02_00356180 predicted 2493
4 SASI_Hs01_00143272 predicted 2043
5 SASI_Hs01_00143273 predicted 1904
6 SASI_Hs01_00143274 predicted 1473
7 SASI_Hs01_00143275 predicted 1221
8 SASI_Hs01_00143276 predicted 562
9 SASI_Hs01_00143277 predicted 1258
10 SASI_Hs01_00143278 predicted 1761
11 SASI_Hs01_00143279 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201690 predicted 656
2 SASI_Rn01_00078385 predicted 834
3 SASI_Rn01_00078386 predicted 972
4 SASI_Rn01_00078387 predicted 1508
5 SASI_Rn01_00078388 predicted 1630
6 SASI_Rn01_00078389 predicted 1750
7 SASI_Rn01_00078390 predicted 2498
8 SASI_Rn01_00078391 predicted 2027
9 SASI_Rn01_00078392 predicted 2530
10 SASI_Rn01_00078393 predicted 973
11 SASI_Rn01_00078394 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105171 predicted 2081
2 SASI_Mm01_00105172 predicted 656
3 SASI_Mm01_00105173 predicted 2000
4 SASI_Mm01_00105174 predicted 1233
5 SASI_Mm01_00105175 predicted 1766
6 SASI_Mm01_00105176 predicted 2286
7 SASI_Mm01_00105177 predicted 2637
8 SASI_Mm01_00105178 predicted 2756
9 SASI_Mm01_00105179 predicted 2125
10 SASI_Mm02_00326675 predicted 909
11 SASI_Mm01_00105180 predicted 2855
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022896
LPIN3 MISSION shRNA Bacterial Glycerol Stock
lipin 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-1907s1c1
Sequence:CCGGCTGCAAGAAGGTGCCAATGATCTCGAGATCATTGGCACCTTCTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-2380s1c1
Sequence:CCGGCTTTGGGAATAGGCCCAATGACTCGAGTCATTGGGCCTATTCCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-2477s1c1
Sequence:CCGGGAGCTCATAAAGAACCACAAACTCGAGTTTGTGGTTCTTTATGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-281s1c1
Sequence:CCGGGTGGTAGACATTGAGCTCAATCTCGAGATTGAGCTCAATGTCTACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-1385s1c1
Sequence:CCGGCTGGACACAGTGGATACAATACTCGAGTATTGTATCCACTGTGTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022896.1-3989s1c1
Sequence:CCGGCGTACCTGAATTTCTCACCTTCTCGAGAAGGTGAGAAATTCAGGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022896.1-3429s1c1
Sequence:CCGGCCAGACATCACTGCCAACATACTCGAGTATGTTGGCAGTGATGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022896.1-3720s1c1
Sequence:CCGGCCACTGTCTTTGAAGAAAGTACTCGAGTACTTTCTTCAAAGACAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-1517s1c1
Sequence:CCGGGACCCAAACCTAGTGGTGAAACTCGAGTTTCACCACTAGGTTTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-2575s1c1
Sequence:CCGGCAACCCTGAATACAGTAACTTCTCGAGAAGTTACTGTATTCAGGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-2392s1c1
Sequence:CCGGGCCCAATGATGTCTTTGCCTACTCGAGTAGGCAAAGACATCATTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022896
LPIN3 MISSION shRNA shRNA Plasmid DNA
lipin 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-1907s1c1
Sequence:CCGGCTGCAAGAAGGTGCCAATGATCTCGAGATCATTGGCACCTTCTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-2380s1c1
Sequence:CCGGCTTTGGGAATAGGCCCAATGACTCGAGTCATTGGGCCTATTCCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-2477s1c1
Sequence:CCGGGAGCTCATAAAGAACCACAAACTCGAGTTTGTGGTTCTTTATGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-281s1c1
Sequence:CCGGGTGGTAGACATTGAGCTCAATCTCGAGATTGAGCTCAATGTCTACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-1385s1c1
Sequence:CCGGCTGGACACAGTGGATACAATACTCGAGTATTGTATCCACTGTGTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022896.1-3989s1c1
Sequence:CCGGCGTACCTGAATTTCTCACCTTCTCGAGAAGGTGAGAAATTCAGGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022896.1-3429s1c1
Sequence:CCGGCCAGACATCACTGCCAACATACTCGAGTATGTTGGCAGTGATGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022896.1-3720s1c1
Sequence:CCGGCCACTGTCTTTGAAGAAAGTACTCGAGTACTTTCTTCAAAGACAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-1517s1c1
Sequence:CCGGGACCCAAACCTAGTGGTGAAACTCGAGTTTCACCACTAGGTTTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-2575s1c1
Sequence:CCGGCAACCCTGAATACAGTAACTTCTCGAGAAGTTACTGTATTCAGGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-2392s1c1
Sequence:CCGGGCCCAATGATGTCTTTGCCTACTCGAGTAGGCAAAGACATCATTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022896
LPIN3 MISSION shRNA Lentiviral Transduction Particles
lipin 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-1907s1c1
Sequence:CCGGCTGCAAGAAGGTGCCAATGATCTCGAGATCATTGGCACCTTCTTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-2380s1c1
Sequence:CCGGCTTTGGGAATAGGCCCAATGACTCGAGTCATTGGGCCTATTCCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-2477s1c1
Sequence:CCGGGAGCTCATAAAGAACCACAAACTCGAGTTTGTGGTTCTTTATGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-281s1c1
Sequence:CCGGGTGGTAGACATTGAGCTCAATCTCGAGATTGAGCTCAATGTCTACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-1385s1c1
Sequence:CCGGCTGGACACAGTGGATACAATACTCGAGTATTGTATCCACTGTGTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022896.1-3989s1c1
Sequence:CCGGCGTACCTGAATTTCTCACCTTCTCGAGAAGGTGAGAAATTCAGGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022896.1-3429s1c1
Sequence:CCGGCCAGACATCACTGCCAACATACTCGAGTATGTTGGCAGTGATGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022896.1-3720s1c1
Sequence:CCGGCCACTGTCTTTGAAGAAAGTACTCGAGTACTTTCTTCAAAGACAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-1517s1c1
Sequence:CCGGGACCCAAACCTAGTGGTGAAACTCGAGTTTCACCACTAGGTTTGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-2575s1c1
Sequence:CCGGCAACCCTGAATACAGTAACTTCTCGAGAAGTTACTGTATTCAGGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022896.1-2392s1c1
Sequence:CCGGGCCCAATGATGTCTTTGCCTACTCGAGTAGGCAAAGACATCATTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022883
LPIN3 MISSION shRNA Bacterial Glycerol Stock
lipin 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000097632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022883.1-2060s1c1
Sequence:CCGGCGGTGTCTAAACCTGAACGAACTCGAGTTCGTTCAGGTTTAGACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097629    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022883.1-2932s1c1
Sequence:CCGGCCGCCACCTTGAAACACAAATCTCGAGATTTGTGTTTCAAGGTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022883.1-911s1c1
Sequence:CCGGCCTAAGAGTGACTCAGAGCTACTCGAGTAGCTCTGAGTCACTCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022883.1-1228s1c1
Sequence:CCGGCCCAGAGAGTAAGGAAACCAACTCGAGTTGGTTTCCTTACTCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022883
LPIN3 MISSION shRNA shRNA Plasmid DNA
lipin 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000097632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022883.1-2060s1c1
Sequence:CCGGCGGTGTCTAAACCTGAACGAACTCGAGTTCGTTCAGGTTTAGACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097629    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022883.1-2932s1c1
Sequence:CCGGCCGCCACCTTGAAACACAAATCTCGAGATTTGTGTTTCAAGGTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022883.1-911s1c1
Sequence:CCGGCCTAAGAGTGACTCAGAGCTACTCGAGTAGCTCTGAGTCACTCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022883.1-1228s1c1
Sequence:CCGGCCCAGAGAGTAAGGAAACCAACTCGAGTTGGTTTCCTTACTCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022883
LPIN3 MISSION shRNA Lentiviral Transduction Particles
lipin 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000097632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022883.1-2060s1c1
Sequence:CCGGCGGTGTCTAAACCTGAACGAACTCGAGTTCGTTCAGGTTTAGACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097629    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022883.1-2932s1c1
Sequence:CCGGCCGCCACCTTGAAACACAAATCTCGAGATTTGTGTTTCAAGGTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022883.1-911s1c1
Sequence:CCGGCCTAAGAGTGACTCAGAGCTACTCGAGTAGCTCTGAGTCACTCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022883.1-1228s1c1
Sequence:CCGGCCCAGAGAGTAAGGAAACCAACTCGAGTTGGTTTCCTTACTCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)