EMAIL THIS PAGE TO A FRIEND

LPL

lipoprotein lipase

136 Gene Product Result for
Synonyms: HDLCQ11 LIPD
UniProtKB ID: P06858, B2R5T9, Q16282, Q16283, Q96FC4
Gene ID:
Human(4023) Summary: LPL encodes lipoprotein lipase, which is expressed in heart, muscle, and adipose tissue. LPL functions as a homodimer, and has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. Severe mutations that cause LPL deficiency result in type I hyperlipoproteinemia, while less extreme mutations in LPL are linked to many disorders of lipoprotein metabolism. [provided by RefSeq, Jul 2008]
Mouse(16956) lipoprotein lipase
Rat(24539) lipoprotein lipase
naked mole-rat(101703016) lipoprotein lipase
domestic guinea pig(100135570) lipoprotein lipase
Goat(100860750) lipoprotein lipase
sheep(443408) lipoprotein lipase
Zebrafish(30354) lipoprotein lipase
chicken(396219) lipoprotein lipase
cow(280843) lipoprotein lipase
Horse(100055358) lipoprotein lipase
domestic cat(727696) lipoprotein lipase
dog(403626) lipoprotein lipase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK109 LPL Activity Assay Kit Supplied by Roar Biomedical, Inc. human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0914 AQUA Peptide SIHLFIDSLLNEENPS[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008509 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008509 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008509 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000237 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000237 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000237 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000237 Rosetta Predictions human pricing
NM_012598 Rosetta Predictions rat pricing
NM_008509 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208454 predicted 1746
2 SASI_Hs01_00208455 predicted 920
3 SASI_Hs01_00208456 predicted 1646
4 SASI_Hs01_00208457 predicted 1563
5 SASI_Hs01_00208458 predicted 628
6 SASI_Hs01_00208459 predicted 1438
7 SASI_Hs01_00208460 predicted 1295
8 SASI_Hs02_00302151 predicted 1809
9 SASI_Hs01_00208461 predicted 982
10 SASI_Hs01_00208462 predicted 613
11 SASI_Hs01_00208463 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012598 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070607 predicted 748
2 SASI_Rn02_00259749 predicted 837
3 SASI_Rn01_00070608 predicted 1190
4 SASI_Rn01_00070609 predicted 796
5 SASI_Rn02_00259750 predicted 463
6 SASI_Rn01_00070610 predicted 1110
7 SASI_Rn01_00070612 predicted 643
8 SASI_Rn01_00070613 predicted 371
9 SASI_Rn02_00259751 predicted 1005
10 SASI_Rn01_00070614 predicted 1096
11 SASI_Rn01_00070611 predicted 1192
12 SASI_Rn01_00070615 predicted 1031
13 SASI_Rn01_00070616 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314064 predicted 712
2 SASI_Mm02_00314065 predicted 1204
3 SASI_Mm02_00314066 predicted 748
4 SASI_Mm02_00314067 predicted 1125
5 SASI_Mm02_00314068 predicted 849
6 SASI_Mm02_00314069 predicted 1393
7 SASI_Mm02_00314070 predicted 1215
8 SASI_Mm02_00314071 predicted 1586
9 SASI_Mm02_00314072 predicted 1426
10 SASI_Mm02_00314073 predicted 1109
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008509
VALIDATED
LPL MISSION shRNA Bacterial Glycerol Stock
lipoprotein lipase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008509.1-2826s1c1
Sequence:CCGGGCCTAGAACTAAACTATGTATCTCGAGATACATAGTTTAGTTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008509.1-1340s1c1
Sequence:CCGGCCCGAGGTTTCCACAAATAAACTCGAGTTTATTTGTGGAAACCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008509.2-841s21c1
Sequence:CCGGGGGTCACCTGGTCGAAGTATTCTCGAGAATACTTCGACCAGGTGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008509.2-1271s21c1
Sequence:CCGGACAACCAGGCCTTCGAGATTTCTCGAGAAATCTCGAAGGCCTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008509.1-1207s1c1
Sequence:CCGGGCCCTACAAAGTGTTCCATTACTCGAGTAATGGAACACTTTGTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008509.1-920s1c1
Sequence:CCGGCCAGGATGCAACATTGGAGAACTCGAGTTCTCCAATGTTGCATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008509.1-883s1c1
Sequence:CCGGGCATGTTGACATTTATCCCAACTCGAGTTGGGATAAATGTCAACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008509.2-711s21c1
Sequence:CCGGGACCAATAAGAAGGTCAATAGCTCGAGCTATTGACCTTCTTATTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008509.2-1892s21c1
Sequence:CCGGTCCCTTAAGAAGGAATCATTTCTCGAGAAATGATTCCTTCTTAAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008509.2-1339s21c1
Sequence:CCGGCCCGAGGTTTCCACAAATAAACTCGAGTTTATTTGTGGAAACCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008509
VALIDATED
LPL MISSION shRNA shRNA Plasmid DNA
lipoprotein lipase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008509.1-2826s1c1
Sequence:CCGGGCCTAGAACTAAACTATGTATCTCGAGATACATAGTTTAGTTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008509.1-1340s1c1
Sequence:CCGGCCCGAGGTTTCCACAAATAAACTCGAGTTTATTTGTGGAAACCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008509.2-841s21c1
Sequence:CCGGGGGTCACCTGGTCGAAGTATTCTCGAGAATACTTCGACCAGGTGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008509.2-1271s21c1
Sequence:CCGGACAACCAGGCCTTCGAGATTTCTCGAGAAATCTCGAAGGCCTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008509.1-1207s1c1
Sequence:CCGGGCCCTACAAAGTGTTCCATTACTCGAGTAATGGAACACTTTGTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008509.1-920s1c1
Sequence:CCGGCCAGGATGCAACATTGGAGAACTCGAGTTCTCCAATGTTGCATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008509.1-883s1c1
Sequence:CCGGGCATGTTGACATTTATCCCAACTCGAGTTGGGATAAATGTCAACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008509.2-711s21c1
Sequence:CCGGGACCAATAAGAAGGTCAATAGCTCGAGCTATTGACCTTCTTATTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008509.2-1892s21c1
Sequence:CCGGTCCCTTAAGAAGGAATCATTTCTCGAGAAATGATTCCTTCTTAAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008509.2-1339s21c1
Sequence:CCGGCCCGAGGTTTCCACAAATAAACTCGAGTTTATTTGTGGAAACCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008509
VALIDATED
LPL MISSION shRNA Lentiviral Transduction Particles
lipoprotein lipase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124549    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008509.1-2826s1c1
Sequence:CCGGGCCTAGAACTAAACTATGTATCTCGAGATACATAGTTTAGTTCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008509.1-1340s1c1
Sequence:CCGGCCCGAGGTTTCCACAAATAAACTCGAGTTTATTTGTGGAAACCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008509.2-841s21c1
Sequence:CCGGGGGTCACCTGGTCGAAGTATTCTCGAGAATACTTCGACCAGGTGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008509.2-1271s21c1
Sequence:CCGGACAACCAGGCCTTCGAGATTTCTCGAGAAATCTCGAAGGCCTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008509.1-1207s1c1
Sequence:CCGGGCCCTACAAAGTGTTCCATTACTCGAGTAATGGAACACTTTGTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008509.1-920s1c1
Sequence:CCGGCCAGGATGCAACATTGGAGAACTCGAGTTCTCCAATGTTGCATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008509.1-883s1c1
Sequence:CCGGGCATGTTGACATTTATCCCAACTCGAGTTGGGATAAATGTCAACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008509.2-711s21c1
Sequence:CCGGGACCAATAAGAAGGTCAATAGCTCGAGCTATTGACCTTCTTATTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008509.2-1892s21c1
Sequence:CCGGTCCCTTAAGAAGGAATCATTTCTCGAGAAATGATTCCTTCTTAAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008509.2-1339s21c1
Sequence:CCGGCCCGAGGTTTCCACAAATAAACTCGAGTTTATTTGTGGAAACCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000237
LPL MISSION shRNA Bacterial Glycerol Stock
lipoprotein lipase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000237.1-1314s1c1
Sequence:CCGGGCCTGAAGTTTCCACAAATAACTCGAGTTATTTGTGGAAACTTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000237.1-1074s1c1
Sequence:CCGGGCTCTGCTTGAGTTGTAGAAACTCGAGTTTCTACAACTCAAGCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000237.1-255s1c1
Sequence:CCGGCGCCGACCAAAGAAGAGATTTCTCGAGAAATCTCTTCTTTGGTCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000237.1-1569s1c1
Sequence:CCGGCCATGACAAGTCTCTGAATAACTCGAGTTATTCAGAGACTTGTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000237.1-733s1c1
Sequence:CCGGCCTAACTTTGAGTATGCAGAACTCGAGTTCTGCATACTCAAAGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000237.2-1305s21c1
Sequence:CCGGATCTGGGCTATGAGATCAATACTCGAGTATTGATCTCATAGCCCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000237.2-2126s21c1
Sequence:CCGGTATTGGGCCATAGCCTATAATCTCGAGATTATAGGCTATGGCCCAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000237.2-2015s21c1
Sequence:CCGGAGCACATCCTCCAACGTTAAACTCGAGTTTAACGTTGGAGGATGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000237
LPL MISSION shRNA shRNA Plasmid DNA
lipoprotein lipase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000237.1-1314s1c1
Sequence:CCGGGCCTGAAGTTTCCACAAATAACTCGAGTTATTTGTGGAAACTTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000237.1-1074s1c1
Sequence:CCGGGCTCTGCTTGAGTTGTAGAAACTCGAGTTTCTACAACTCAAGCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000237.1-255s1c1
Sequence:CCGGCGCCGACCAAAGAAGAGATTTCTCGAGAAATCTCTTCTTTGGTCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000237.1-1569s1c1
Sequence:CCGGCCATGACAAGTCTCTGAATAACTCGAGTTATTCAGAGACTTGTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000237.1-733s1c1
Sequence:CCGGCCTAACTTTGAGTATGCAGAACTCGAGTTCTGCATACTCAAAGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000237.2-1305s21c1
Sequence:CCGGATCTGGGCTATGAGATCAATACTCGAGTATTGATCTCATAGCCCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000237.2-2126s21c1
Sequence:CCGGTATTGGGCCATAGCCTATAATCTCGAGATTATAGGCTATGGCCCAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000237.2-2015s21c1
Sequence:CCGGAGCACATCCTCCAACGTTAAACTCGAGTTTAACGTTGGAGGATGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000237
LPL MISSION shRNA Lentiviral Transduction Particles
lipoprotein lipase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000237.1-1314s1c1
Sequence:CCGGGCCTGAAGTTTCCACAAATAACTCGAGTTATTTGTGGAAACTTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000237.1-1074s1c1
Sequence:CCGGGCTCTGCTTGAGTTGTAGAAACTCGAGTTTCTACAACTCAAGCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000237.1-255s1c1
Sequence:CCGGCGCCGACCAAAGAAGAGATTTCTCGAGAAATCTCTTCTTTGGTCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000237.1-1569s1c1
Sequence:CCGGCCATGACAAGTCTCTGAATAACTCGAGTTATTCAGAGACTTGTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000237.1-733s1c1
Sequence:CCGGCCTAACTTTGAGTATGCAGAACTCGAGTTCTGCATACTCAAAGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000237.2-1305s21c1
Sequence:CCGGATCTGGGCTATGAGATCAATACTCGAGTATTGATCTCATAGCCCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000237.2-2126s21c1
Sequence:CCGGTATTGGGCCATAGCCTATAATCTCGAGATTATAGGCTATGGCCCAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000237.2-2015s21c1
Sequence:CCGGAGCACATCCTCCAACGTTAAACTCGAGTTTAACGTTGGAGGATGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)