EMAIL THIS PAGE TO A FRIEND

LPO

lactoperoxidase

51 Gene Product Result for
Synonyms: SPO
UniProtKB ID: P22079, A5JUY4, E7EMJ3, Q13408, Q3KNQ2
Gene ID:
Human(4025) Summary: This gene encodes an oxidoreductase secreted from salivary, mammary, and other mucosal glands that functions as a natural antibacterial agent. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Mouse(76113) lactoperoxidase
Rat(287610) lactoperoxidase
Goat(100860761) lactoperoxidase
sheep(443004) lactoperoxidase
naked mole-rat(101706753) lactoperoxidase
Domestic Rabbit(100355726) lactoperoxidase
chicken(417466) lactoperoxidase
domestic cat(101083378) lactoperoxidase
cow(280844) lactoperoxidase
Horse(100056877) lactoperoxidase
dog(491111) lactoperoxidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006151 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006151 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006151 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006151 Rosetta Predictions human pricing
NM_001105829 Rosetta Predictions rat pricing
NM_080420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042632 predicted 1760
2 SASI_Hs01_00042633 predicted 2243
3 SASI_Hs01_00042634 predicted 2430
4 SASI_Hs01_00042635 predicted 1997
5 SASI_Hs01_00042636 predicted 849
6 SASI_Hs01_00042637 predicted 836
7 SASI_Hs01_00042638 predicted 2464
8 SASI_Hs01_00042639 predicted 2033
9 SASI_Hs01_00042640 predicted 667
10 SASI_Hs01_00042641 predicted 1672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105829 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212936 predicted 1846
2 SASI_Rn02_00212937 predicted 1626
3 SASI_Rn02_00212938 predicted 1686
4 SASI_Rn02_00212939 predicted 1259
5 SASI_Rn02_00212940 predicted 1582
6 SASI_Rn02_00212941 predicted 2306
7 SASI_Rn02_00212942 predicted 1201
8 SASI_Rn02_00212943 predicted 1673
9 SASI_Rn02_00212944 predicted 2086
10 SASI_Rn02_00212945 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069882 predicted 2339
2 SASI_Mm01_00069883 predicted 2448
3 SASI_Mm01_00069884 predicted 1703
4 SASI_Mm02_00338085 predicted 1322
5 SASI_Mm01_00069886 predicted 967
6 SASI_Mm01_00069887 predicted 1564
7 SASI_Mm01_00069888 predicted 1114
8 SASI_Mm01_00069889 predicted 1037
9 SASI_Mm01_00069890 predicted 2530
10 SASI_Mm01_00069891 predicted 1644
11 SASI_Mm01_00069885 predicted 714
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006151
LPO MISSION shRNA Bacterial Glycerol Stock
lactoperoxidase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006151.2-737s21c1
Sequence:CCGGATTACGGGAGACTGCAATAACCTCGAGGTTATTGCAGTCTCCCGTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006151.2-2742s21c1
Sequence:CCGGAGTCTTGGCCCTTAACCTTTACTCGAGTAAAGGTTAAGGGCCAAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006151.1-831s1c1
Sequence:CCGGCCGGGAGGTATCTAACAAGATCTCGAGATCTTGTTAGATACCTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006151.1-1561s1c1
Sequence:CCGGGACCACATGCAGAAGTGGATACTCGAGTATCCACTTCTGCATGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006151.1-986s1c1
Sequence:CCGGCCCAGTGTGATGAGTACTGTACTCGAGTACAGTACTCATCACACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006151.1-1817s1c1
Sequence:CCGGCCAAGCTGATGAAACAGAATACTCGAGTATTCTGTTTCATCAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006151.1-1989s1c1
Sequence:CCGGGCAGACACTAGAGGAGTTGAACTCGAGTTCAACTCCTCTAGTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006151
LPO MISSION shRNA shRNA Plasmid DNA
lactoperoxidase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006151.2-737s21c1
Sequence:CCGGATTACGGGAGACTGCAATAACCTCGAGGTTATTGCAGTCTCCCGTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006151.2-2742s21c1
Sequence:CCGGAGTCTTGGCCCTTAACCTTTACTCGAGTAAAGGTTAAGGGCCAAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006151.1-831s1c1
Sequence:CCGGCCGGGAGGTATCTAACAAGATCTCGAGATCTTGTTAGATACCTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006151.1-1561s1c1
Sequence:CCGGGACCACATGCAGAAGTGGATACTCGAGTATCCACTTCTGCATGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006151.1-986s1c1
Sequence:CCGGCCCAGTGTGATGAGTACTGTACTCGAGTACAGTACTCATCACACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006151.1-1817s1c1
Sequence:CCGGCCAAGCTGATGAAACAGAATACTCGAGTATTCTGTTTCATCAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006151.1-1989s1c1
Sequence:CCGGGCAGACACTAGAGGAGTTGAACTCGAGTTCAACTCCTCTAGTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006151
LPO MISSION shRNA Lentiviral Transduction Particles
lactoperoxidase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006151.2-737s21c1
Sequence:CCGGATTACGGGAGACTGCAATAACCTCGAGGTTATTGCAGTCTCCCGTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416900    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006151.2-2742s21c1
Sequence:CCGGAGTCTTGGCCCTTAACCTTTACTCGAGTAAAGGTTAAGGGCCAAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006151.1-831s1c1
Sequence:CCGGCCGGGAGGTATCTAACAAGATCTCGAGATCTTGTTAGATACCTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006151.1-1561s1c1
Sequence:CCGGGACCACATGCAGAAGTGGATACTCGAGTATCCACTTCTGCATGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006151.1-986s1c1
Sequence:CCGGCCCAGTGTGATGAGTACTGTACTCGAGTACAGTACTCATCACACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006151.1-1817s1c1
Sequence:CCGGCCAAGCTGATGAAACAGAATACTCGAGTATTCTGTTTCATCAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006151.1-1989s1c1
Sequence:CCGGGCAGACACTAGAGGAGTTGAACTCGAGTTCAACTCCTCTAGTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080420
LPO MISSION shRNA Bacterial Glycerol Stock
lactoperoxidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080420.1-1972s1c1
Sequence:CCGGCGAGCTTCGAAACAAGCTGTTCTCGAGAACAGCTTGTTTCGAAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080420.1-1320s1c1
Sequence:CCGGGCCTGGCAAATCGACTTAGAACTCGAGTTCTAAGTCGATTTGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080420.1-2786s1c1
Sequence:CCGGCGTCCTCTAAGACTAGCTCATCTCGAGATGAGCTAGTCTTAGAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080420.1-664s1c1
Sequence:CCGGCCTAAAGAAACTGTCTCAGTTCTCGAGAACTGAGACAGTTTCTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080420.1-953s1c1
Sequence:CCGGCGTGAAGTCTCTAACCAGATTCTCGAGAATCTGGTTAGAGACTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080420
LPO MISSION shRNA shRNA Plasmid DNA
lactoperoxidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080420.1-1972s1c1
Sequence:CCGGCGAGCTTCGAAACAAGCTGTTCTCGAGAACAGCTTGTTTCGAAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080420.1-1320s1c1
Sequence:CCGGGCCTGGCAAATCGACTTAGAACTCGAGTTCTAAGTCGATTTGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080420.1-2786s1c1
Sequence:CCGGCGTCCTCTAAGACTAGCTCATCTCGAGATGAGCTAGTCTTAGAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080420.1-664s1c1
Sequence:CCGGCCTAAAGAAACTGTCTCAGTTCTCGAGAACTGAGACAGTTTCTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080420.1-953s1c1
Sequence:CCGGCGTGAAGTCTCTAACCAGATTCTCGAGAATCTGGTTAGAGACTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080420
LPO MISSION shRNA Lentiviral Transduction Particles
lactoperoxidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080420.1-1972s1c1
Sequence:CCGGCGAGCTTCGAAACAAGCTGTTCTCGAGAACAGCTTGTTTCGAAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080420.1-1320s1c1
Sequence:CCGGGCCTGGCAAATCGACTTAGAACTCGAGTTCTAAGTCGATTTGCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080420.1-2786s1c1
Sequence:CCGGCGTCCTCTAAGACTAGCTCATCTCGAGATGAGCTAGTCTTAGAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080420.1-664s1c1
Sequence:CCGGCCTAAAGAAACTGTCTCAGTTCTCGAGAACTGAGACAGTTTCTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080420.1-953s1c1
Sequence:CCGGCGTGAAGTCTCTAACCAGATTCTCGAGAATCTGGTTAGAGACTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)