EMAIL THIS PAGE TO A FRIEND

LPPR3

37 Gene Product Result for
Synonyms: LPR3 PRG-2 PRG2
UniProtKB ID: Q6T4P5, Q86XQ4, Q96EH1, Q9BQF9, Q9HAJ4
Gene ID:
Human(79948) Summary: The proteins in the lipid phosphate phosphatase (LPP) family, including PRG2, are integral membrane proteins that modulate bioactive lipid phosphates including phosphatidate, lysophosphatidate, and sphingosine-1-phosphate in the context of cell migration, neurite retraction, and mitogenesis (Brauer et al., 2003 [PubMed 12730698]
Rat(314614) lipid phosphate phosphatase-related protein type 3
dog(485096) lipid phosphate phosphatase-related protein type 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024888 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024888 Rosetta Predictions human pricing
NM_181634 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183922 predicted 701
2 SASI_Hs01_00183923 predicted 696
3 SASI_Hs01_00183924 predicted 647
4 SASI_Hs01_00183928 predicted 1980
5 SASI_Hs02_00357481 predicted 704
6 SASI_Hs01_00183929 predicted 1867
7 SASI_Hs02_00357482 predicted 698
8 SASI_Hs01_00183930 predicted 623
9 SASI_Hs02_00357483 predicted 1865
10 SASI_Hs01_00183931 predicted 2055
11 SASI_Hs01_00183925 predicted 725
12 SASI_Hs01_00183926 predicted 1873
13 SASI_Hs01_00183927 predicted 1873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181634 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086662 predicted 983
2 SASI_Rn01_00086663 predicted 817
3 SASI_Rn01_00086664 predicted 540
4 SASI_Rn01_00086665 predicted 1273
5 SASI_Rn01_00086666 predicted 880
6 SASI_Rn01_00086668 predicted 1096
7 SASI_Rn02_00269774 predicted 670
8 SASI_Rn01_00086669 predicted 550
9 SASI_Rn01_00086670 predicted 2094
10 SASI_Rn01_00086671 predicted 736
11 SASI_Rn01_00086667 predicted 743
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024888
LPPR3 MISSION shRNA Bacterial Glycerol Stock
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024888.1-97s21c1
Sequence:CCGGGAAGGACAGCATGACGCTTCTCTCGAGAGAAGCGTCATGCTGTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024888.1-807s21c1
Sequence:CCGGTGTACTTCAACTCGGTCATCTCTCGAGAGATGACCGAGTTGAAGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024888.1-148s21c1
Sequence:CCGGAGTGGCTTCTTCCATCGTATCCTCGAGGATACGATGGAAGAAGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024888.1-1081s21c1
Sequence:CCGGCGACTCGGTTTATCAGCAGAACTCGAGTTCTGCTGATAAACCGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024888.1-1082s1c1
Sequence:CCGGGACTCGGTTTATCAGCAGAATCTCGAGATTCTGCTGATAAACCGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024888.1-163s1c1
Sequence:CCGGCGTATCCTTGTACTTCCTGGACTCGAGTCCAGGAAGTACAAGGATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024888.1-1363s1c1
Sequence:CCGGGCAGCTCATCAGCGAGTGGAACTCGAGTTCCACTCGCTGATGAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024888.1-895s1c1
Sequence:CCGGGCTCACGCAGATCACGCAGTACTCGAGTACTGCGTGATCTGCGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024888.1-805s1c1
Sequence:CCGGGATGTACTTCAACTCGGTCATCTCGAGATGACCGAGTTGAAGTACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024888
LPPR3 MISSION shRNA shRNA Plasmid DNA
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024888.1-97s21c1
Sequence:CCGGGAAGGACAGCATGACGCTTCTCTCGAGAGAAGCGTCATGCTGTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024888.1-807s21c1
Sequence:CCGGTGTACTTCAACTCGGTCATCTCTCGAGAGATGACCGAGTTGAAGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024888.1-148s21c1
Sequence:CCGGAGTGGCTTCTTCCATCGTATCCTCGAGGATACGATGGAAGAAGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024888.1-1081s21c1
Sequence:CCGGCGACTCGGTTTATCAGCAGAACTCGAGTTCTGCTGATAAACCGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024888.1-1082s1c1
Sequence:CCGGGACTCGGTTTATCAGCAGAATCTCGAGATTCTGCTGATAAACCGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024888.1-163s1c1
Sequence:CCGGCGTATCCTTGTACTTCCTGGACTCGAGTCCAGGAAGTACAAGGATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024888.1-1363s1c1
Sequence:CCGGGCAGCTCATCAGCGAGTGGAACTCGAGTTCCACTCGCTGATGAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024888.1-895s1c1
Sequence:CCGGGCTCACGCAGATCACGCAGTACTCGAGTACTGCGTGATCTGCGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024888.1-805s1c1
Sequence:CCGGGATGTACTTCAACTCGGTCATCTCGAGATGACCGAGTTGAAGTACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024888
LPPR3 MISSION shRNA Lentiviral Transduction Particles
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024888.1-97s21c1
Sequence:CCGGGAAGGACAGCATGACGCTTCTCTCGAGAGAAGCGTCATGCTGTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024888.1-807s21c1
Sequence:CCGGTGTACTTCAACTCGGTCATCTCTCGAGAGATGACCGAGTTGAAGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024888.1-148s21c1
Sequence:CCGGAGTGGCTTCTTCCATCGTATCCTCGAGGATACGATGGAAGAAGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024888.1-1081s21c1
Sequence:CCGGCGACTCGGTTTATCAGCAGAACTCGAGTTCTGCTGATAAACCGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024888.1-1082s1c1
Sequence:CCGGGACTCGGTTTATCAGCAGAATCTCGAGATTCTGCTGATAAACCGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024888.1-163s1c1
Sequence:CCGGCGTATCCTTGTACTTCCTGGACTCGAGTCCAGGAAGTACAAGGATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024888.1-1363s1c1
Sequence:CCGGGCAGCTCATCAGCGAGTGGAACTCGAGTTCCACTCGCTGATGAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024888.1-895s1c1
Sequence:CCGGGCTCACGCAGATCACGCAGTACTCGAGTACTGCGTGATCTGCGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024888.1-805s1c1
Sequence:CCGGGATGTACTTCAACTCGGTCATCTCGAGATGACCGAGTTGAAGTACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)