EMAIL THIS PAGE TO A FRIEND

LPPR4

211 Gene Product Result for
Synonyms: LPR4 PHP1 PRG-1 PRG1 RP4-788L13.1
Gene ID:
Human(9890) Summary: The protein encoded by this gene belongs to the lipid phosphate phosphatase (LPP) family. LPPs catalyze the dephosphorylation of a number of bioactive lipid mediators that regulate a variety of cell functions. This protein is specifically expressed in neurons. It is located in the membranes of outgrowing axons and has been shown to be important for axonal outgrowth during development and regenerative sprouting. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Rat(295401) lipid phosphate phosphatase-related protein type 4
chicken(424476) lipid phosphate phosphatase-related protein type 4
domestic cat(100169701) lipid phosphate phosphatase-related protein type 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014839 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089851 MISSION® esiRNA esiRNA human RP4-788L13.1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014839 Rosetta Predictions human pricing
NM_001001508 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089010 predicted 1456
2 SASI_Hs02_00346397 predicted 665
3 SASI_Hs01_00089011 predicted 419
4 SASI_Hs01_00089012 predicted 1151
5 SASI_Hs01_00089013 predicted 568
6 SASI_Hs02_00346398 predicted 1276
7 SASI_Hs01_00089014 predicted 1981
8 SASI_Hs02_00346399 predicted 402
9 SASI_Hs01_00089015 predicted 2081
10 SASI_Hs01_00089016 predicted 627
11 SASI_Hs01_00089009 predicted 991
12 SASI_Hs01_00089017 predicted 1094
13 SASI_Hs01_00089018 predicted 2483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079761 predicted 1556
2 SASI_Rn01_00079762 predicted 1894
3 SASI_Rn01_00079763 predicted 1455
4 SASI_Rn01_00079764 predicted 1384
5 SASI_Rn01_00079765 predicted 2575
6 SASI_Rn01_00079766 predicted 909
7 SASI_Rn01_00079767 predicted 1545
8 SASI_Rn01_00079768 predicted 889
9 SASI_Rn01_00079769 predicted 1943
10 SASI_Rn01_00079770 predicted 1493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014839
LPPR4 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014839.3-629s1c1
Sequence:CCGGGCTGTCAGATTCGTTGGTGTTCTCGAGAACACCAACGAATCTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014839.3-1447s1c1
Sequence:CCGGCCTCACCCAGTGGAAGAATAACTCGAGTTATTCTTCCACTGGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014839.3-503s1c1
Sequence:CCGGCCTGCAATTACGATTATGGTACTCGAGTACCATAATCGTAATTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014839.3-2159s1c1
Sequence:CCGGCGCAAGAGAAGCAACATTGATCTCGAGATCAATGTTGCTTCTCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014839.3-743s1c1
Sequence:CCGGCCAAACTATACCTCTCTGAATCTCGAGATTCAGAGAGGTATAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014839.3-2842s21c1
Sequence:CCGGATACGGGTGGTGCTGATTATTCTCGAGAATAATCAGCACCACCCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014839.3-319s21c1
Sequence:CCGGTTTCGTCGAGTTGCCTATATTCTCGAGAATATAGGCAACTCGACGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014839.3-347s21c1
Sequence:CCGGTCGGTGGTTAGCCTCTATTTCCTCGAGGAAATAGAGGCTAACCACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014839
LPPR4 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014839.3-629s1c1
Sequence:CCGGGCTGTCAGATTCGTTGGTGTTCTCGAGAACACCAACGAATCTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014839.3-1447s1c1
Sequence:CCGGCCTCACCCAGTGGAAGAATAACTCGAGTTATTCTTCCACTGGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014839.3-503s1c1
Sequence:CCGGCCTGCAATTACGATTATGGTACTCGAGTACCATAATCGTAATTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014839.3-2159s1c1
Sequence:CCGGCGCAAGAGAAGCAACATTGATCTCGAGATCAATGTTGCTTCTCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014839.3-743s1c1
Sequence:CCGGCCAAACTATACCTCTCTGAATCTCGAGATTCAGAGAGGTATAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014839.3-2842s21c1
Sequence:CCGGATACGGGTGGTGCTGATTATTCTCGAGAATAATCAGCACCACCCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014839.3-319s21c1
Sequence:CCGGTTTCGTCGAGTTGCCTATATTCTCGAGAATATAGGCAACTCGACGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014839.3-347s21c1
Sequence:CCGGTCGGTGGTTAGCCTCTATTTCCTCGAGGAAATAGAGGCTAACCACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014839
LPPR4 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014839.3-629s1c1
Sequence:CCGGGCTGTCAGATTCGTTGGTGTTCTCGAGAACACCAACGAATCTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014839.3-1447s1c1
Sequence:CCGGCCTCACCCAGTGGAAGAATAACTCGAGTTATTCTTCCACTGGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014839.3-503s1c1
Sequence:CCGGCCTGCAATTACGATTATGGTACTCGAGTACCATAATCGTAATTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014839.3-2159s1c1
Sequence:CCGGCGCAAGAGAAGCAACATTGATCTCGAGATCAATGTTGCTTCTCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014839.3-743s1c1
Sequence:CCGGCCAAACTATACCTCTCTGAATCTCGAGATTCAGAGAGGTATAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014839.3-2842s21c1
Sequence:CCGGATACGGGTGGTGCTGATTATTCTCGAGAATAATCAGCACCACCCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014839.3-319s21c1
Sequence:CCGGTTTCGTCGAGTTGCCTATATTCTCGAGAATATAGGCAACTCGACGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014839.3-347s21c1
Sequence:CCGGTCGGTGGTTAGCCTCTATTTCCTCGAGGAAATAGAGGCTAACCACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)