EMAIL THIS PAGE TO A FRIEND

LPPR5

164 Gene Product Result for
Synonyms: PAP2 PAP2D PRG5
UniProtKB ID: Q32ZL2, A8MPX4, B7UCH3, Q32ZD0, Q3ZCU7
Gene ID:
Human(163404) Summary: The protein encoded by this gene is a type 2 member of the phosphatidic acid phosphatase (PAP) family. All type 2 members of this protein family contain 6 transmembrane regions, and a consensus N-glycosylation site. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Rat(310812) lipid phosphate phosphatase-related protein type 5
chicken(424477) lipid phosphate phosphatase-related protein type 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037317 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_375754 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375754 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375754 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119161 MISSION® esiRNA esiRNA human PPAPR5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010861 Rosetta Predictions human pricing
NM_001037317 Rosetta Predictions human pricing
NM_001107720 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082758 predicted 886
2 SASI_Hs01_00082759 predicted 816
3 SASI_Hs01_00082760 predicted 892
4 SASI_Hs01_00082761 predicted 574
5 SASI_Hs01_00082762 predicted 904
6 SASI_Hs01_00082763 predicted 883
7 SASI_Hs02_00305800 predicted 876
8 SASI_Hs02_00305801 predicted 632
9 SASI_Hs01_00082764 predicted 888
10 SASI_Hs01_00082765 predicted 535
11 SASI_Hs01_00082766 predicted 713
12 SASI_Hs01_00082767 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077958 predicted 884
2 SASI_Hs01_00077959 predicted 811
3 SASI_Hs01_00077960 predicted 890
4 SASI_Hs01_00077961 predicted 574
5 SASI_Hs01_00077962 predicted 903
6 SASI_Hs01_00077963 predicted 891
7 SASI_Hs02_00308259 predicted 877
8 SASI_Hs02_00308260 predicted 636
9 SASI_Hs01_00077964 predicted 891
10 SASI_Hs01_00077965 predicted 531
11 SASI_Hs01_00077966 predicted 722
12 SASI_Hs01_00077967 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231605 predicted 1334
2 SASI_Rn02_00231606 predicted 1533
3 SASI_Rn02_00231607 predicted 989
4 SASI_Rn02_00231608 predicted 1201
5 SASI_Rn02_00231609 predicted 1404
6 SASI_Rn02_00231610 predicted 975
7 SASI_Rn02_00231611 predicted 917
8 SASI_Rn02_00231612 predicted 1292
9 SASI_Rn02_00231613 predicted 1354
10 SASI_Rn02_00231614 predicted 1485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037317
LPPR5 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000359854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037317.1-580s21c1
Sequence:CCGGGTCCGATTTCTTGGAATTTATCTCGAGATAAATTCCAAGAAATCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037317.1-680s21c1
Sequence:CCGGCCCTGTGTAAGCCCAATTATACTCGAGTATAATTGGGCTTACACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037317.1-299s21c1
Sequence:CCGGTGGCGTACTACTTCGAGTATACTCGAGTATACTCGAAGTAGTACGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037317.1-1524s21c1
Sequence:CCGGTCTCTACATAAATCGTATTTGCTCGAGCAAATACGATTTATGTAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037317
LPPR5 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000359854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037317.1-580s21c1
Sequence:CCGGGTCCGATTTCTTGGAATTTATCTCGAGATAAATTCCAAGAAATCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037317.1-680s21c1
Sequence:CCGGCCCTGTGTAAGCCCAATTATACTCGAGTATAATTGGGCTTACACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037317.1-299s21c1
Sequence:CCGGTGGCGTACTACTTCGAGTATACTCGAGTATACTCGAAGTAGTACGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037317.1-1524s21c1
Sequence:CCGGTCTCTACATAAATCGTATTTGCTCGAGCAAATACGATTTATGTAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037317
LPPR5 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000359854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037317.1-580s21c1
Sequence:CCGGGTCCGATTTCTTGGAATTTATCTCGAGATAAATTCCAAGAAATCGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037317.1-680s21c1
Sequence:CCGGCCCTGTGTAAGCCCAATTATACTCGAGTATAATTGGGCTTACACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037317.1-299s21c1
Sequence:CCGGTGGCGTACTACTTCGAGTATACTCGAGTATACTCGAAGTAGTACGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037317.1-1524s21c1
Sequence:CCGGTCTCTACATAAATCGTATTTGCTCGAGCAAATACGATTTATGTAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375754
LPPR5 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000082790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375754.2-841s1c1
Sequence:CCGGCAGTTCTATGCTTGGGCTTAACTCGAGTTAAGCCCAAGCATAGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375754.2-2154s1c1
Sequence:CCGGCCTCATAATAACCTGGTATAACTCGAGTTATACCAGGTTATTATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375754.2-257s1c1
Sequence:CCGGCTTCGAGTATACGGACACGTTCTCGAGAACGTGTCCGTATACTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375754.2-930s1c1
Sequence:CCGGGCAGGCTTTCTGGTTGGAATACTCGAGTATTCCAACCAGAAAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375754
LPPR5 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000082790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375754.2-841s1c1
Sequence:CCGGCAGTTCTATGCTTGGGCTTAACTCGAGTTAAGCCCAAGCATAGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375754.2-2154s1c1
Sequence:CCGGCCTCATAATAACCTGGTATAACTCGAGTTATACCAGGTTATTATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375754.2-257s1c1
Sequence:CCGGCTTCGAGTATACGGACACGTTCTCGAGAACGTGTCCGTATACTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375754.2-930s1c1
Sequence:CCGGGCAGGCTTTCTGGTTGGAATACTCGAGTATTCCAACCAGAAAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375754
LPPR5 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000082790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375754.2-841s1c1
Sequence:CCGGCAGTTCTATGCTTGGGCTTAACTCGAGTTAAGCCCAAGCATAGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_375754.2-2154s1c1
Sequence:CCGGCCTCATAATAACCTGGTATAACTCGAGTTATACCAGGTTATTATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375754.2-257s1c1
Sequence:CCGGCTTCGAGTATACGGACACGTTCTCGAGAACGTGTCCGTATACTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375754.2-930s1c1
Sequence:CCGGGCAGGCTTTCTGGTTGGAATACTCGAGTATTCCAACCAGAAAGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)