EMAIL THIS PAGE TO A FRIEND

LRAT

lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)

161 Gene Product Result for
Synonyms: LCA14
UniProtKB ID: O95237, A8K983, Q8N716
Gene ID:
Human(9227) Summary: The protein encoded by this gene is a microsomal enzyme that catalyzes the esterification of all-trans-retinol into all-trans-retinyl ester, an essential reaction for the retinoid cycle in visual system and vitamin A status in liver. Mutations in this gene have been associated with early-onset severe retinal dystrophy. [provided by RefSeq, Jul 2008]
Mouse(79235) lecithin-retinol acyltransferase (phosphatidylcholine-retinol-O-acyltransferase)
Rat(64047) lecithin-retinol acyltransferase (phosphatidylcholine-retinol-O-acyltransferase)
chicken(422403) lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)
dog(482660) lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)
cow(281285) lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)
domestic cat(101092432) lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)
sheep(101123410) lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023624 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023624 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023624 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004744 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004744 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004744 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004744 Rosetta Predictions human pricing
NM_022280 Rosetta Predictions rat pricing
NM_023624 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149355 predicted 492
2 SASI_Hs01_00149356 predicted 826
3 SASI_Hs01_00149357 predicted 546
4 SASI_Hs01_00149359 predicted 387
5 SASI_Hs01_00149360 predicted 816
6 SASI_Hs01_00149361 predicted 307
7 SASI_Hs01_00149362 predicted 571
8 SASI_Hs01_00149363 predicted 960
9 SASI_Hs02_00338225 predicted 427
10 SASI_Hs02_00338226 predicted 380
11 SASI_Hs01_00149354 predicted 810
12 SASI_Hs01_00149358 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022280 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090107 predicted 865
2 SASI_Rn01_00090108 predicted 1087
3 SASI_Rn01_00090109 predicted 381
4 SASI_Rn01_00090110 predicted 842
5 SASI_Rn01_00090112 predicted 787
6 SASI_Rn01_00090113 predicted 1012
7 SASI_Rn02_00263091 predicted 1233
8 SASI_Rn01_00090114 predicted 1250
9 SASI_Rn01_00090115 predicted 1217
10 SASI_Rn01_00090116 predicted 421
11 SASI_Rn01_00090111 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023624 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059100 predicted 648
2 SASI_Mm02_00327224 predicted 359
3 SASI_Mm02_00327225 predicted 747
4 SASI_Mm02_00327226 predicted 728
5 SASI_Mm02_00327227 predicted 856
6 SASI_Mm01_00059104 predicted 372
7 SASI_Mm02_00327228 predicted 618
8 SASI_Mm02_00327229 predicted 654
9 SASI_Mm02_00327230 predicted 476
10 SASI_Mm02_00327231 predicted 1054
11 SASI_Mm01_00059101 predicted 1325
12 SASI_Mm01_00059102 predicted 1318
13 SASI_Mm01_00059103 predicted 535
14 SASI_Mm01_00059105 predicted 742
15 SASI_Mm01_00059106 predicted 620
16 SASI_Mm01_00059107 predicted 1342
17 SASI_Mm01_00059108 predicted 481
18 SASI_Mm01_00059109 predicted 308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023624
LRAT MISSION shRNA Bacterial Glycerol Stock
lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000176199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023624.1-864s1c1
Sequence:CCGGGTCTTGGGATTAGCATCTATTCTCGAGAATAGATGCTAATCCCAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023624.1-314s1c1
Sequence:CCGGGCTCCTTATTTCCAACTTCAACTCGAGTTGAAGTTGGAAATAAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023624.1-748s1c1
Sequence:CCGGGCGAACACTTTGTGACTTACTCTCGAGAGTAAGTCACAAAGTGTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023624.1-813s1c1
Sequence:CCGGGACACCGTGAAGATAATCATTCTCGAGAATGATTATCTTCACGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023624
LRAT MISSION shRNA shRNA Plasmid DNA
lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000176199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023624.1-864s1c1
Sequence:CCGGGTCTTGGGATTAGCATCTATTCTCGAGAATAGATGCTAATCCCAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023624.1-314s1c1
Sequence:CCGGGCTCCTTATTTCCAACTTCAACTCGAGTTGAAGTTGGAAATAAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023624.1-748s1c1
Sequence:CCGGGCGAACACTTTGTGACTTACTCTCGAGAGTAAGTCACAAAGTGTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023624.1-813s1c1
Sequence:CCGGGACACCGTGAAGATAATCATTCTCGAGAATGATTATCTTCACGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023624
LRAT MISSION shRNA Lentiviral Transduction Particles
lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000176199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023624.1-864s1c1
Sequence:CCGGGTCTTGGGATTAGCATCTATTCTCGAGAATAGATGCTAATCCCAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023624.1-314s1c1
Sequence:CCGGGCTCCTTATTTCCAACTTCAACTCGAGTTGAAGTTGGAAATAAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023624.1-748s1c1
Sequence:CCGGGCGAACACTTTGTGACTTACTCTCGAGAGTAAGTCACAAAGTGTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023624.1-813s1c1
Sequence:CCGGGACACCGTGAAGATAATCATTCTCGAGAATGATTATCTTCACGGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004744
LRAT MISSION shRNA Bacterial Glycerol Stock
lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004744.3-567s1c1
Sequence:CCGGCGGAGCTAACATCCTGGTCAACTCGAGTTGACCAGGATGTTAGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004744.3-811s1c1
Sequence:CCGGGTCTTGGGATTGGCGTCTATACTCGAGTATAGACGCCAATCCCAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004744.3-499s1c1
Sequence:CCGGCGTCTCATCCTGGGCGTTATTCTCGAGAATAACGCCCAGGATGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004744.3-269s1c1
Sequence:CCGGTCTCCAACTTCACGCTCTTTACTCGAGTAAAGAGCGTGAAGTTGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004744.3-384s1c1
Sequence:CCGGCCTGACCCACTATGGCATCTACTCGAGTAGATGCCATAGTGGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004744.3-1269s21c1
Sequence:CCGGATATTGAGACCAGTAACTTTACTCGAGTAAAGTTACTGGTCTCAATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004744.3-1232s21c1
Sequence:CCGGTTGTACTGTTCGGCTGAATTTCTCGAGAAATTCAGCCGAACAGTACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004744
LRAT MISSION shRNA shRNA Plasmid DNA
lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004744.3-567s1c1
Sequence:CCGGCGGAGCTAACATCCTGGTCAACTCGAGTTGACCAGGATGTTAGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004744.3-811s1c1
Sequence:CCGGGTCTTGGGATTGGCGTCTATACTCGAGTATAGACGCCAATCCCAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004744.3-499s1c1
Sequence:CCGGCGTCTCATCCTGGGCGTTATTCTCGAGAATAACGCCCAGGATGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004744.3-269s1c1
Sequence:CCGGTCTCCAACTTCACGCTCTTTACTCGAGTAAAGAGCGTGAAGTTGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004744.3-384s1c1
Sequence:CCGGCCTGACCCACTATGGCATCTACTCGAGTAGATGCCATAGTGGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004744.3-1269s21c1
Sequence:CCGGATATTGAGACCAGTAACTTTACTCGAGTAAAGTTACTGGTCTCAATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004744.3-1232s21c1
Sequence:CCGGTTGTACTGTTCGGCTGAATTTCTCGAGAAATTCAGCCGAACAGTACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004744
LRAT MISSION shRNA Lentiviral Transduction Particles
lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004744.3-567s1c1
Sequence:CCGGCGGAGCTAACATCCTGGTCAACTCGAGTTGACCAGGATGTTAGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004744.3-811s1c1
Sequence:CCGGGTCTTGGGATTGGCGTCTATACTCGAGTATAGACGCCAATCCCAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004744.3-499s1c1
Sequence:CCGGCGTCTCATCCTGGGCGTTATTCTCGAGAATAACGCCCAGGATGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004744.3-269s1c1
Sequence:CCGGTCTCCAACTTCACGCTCTTTACTCGAGTAAAGAGCGTGAAGTTGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004744.3-384s1c1
Sequence:CCGGCCTGACCCACTATGGCATCTACTCGAGTAGATGCCATAGTGGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004744.3-1269s21c1
Sequence:CCGGATATTGAGACCAGTAACTTTACTCGAGTAAAGTTACTGGTCTCAATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004744.3-1232s21c1
Sequence:CCGGTTGTACTGTTCGGCTGAATTTCTCGAGAAATTCAGCCGAACAGTACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)