EMAIL THIS PAGE TO A FRIEND

LRBA

LPS-responsive vesicle trafficking, beach and anchor containing

113 Gene Product Result for
Synonyms: BGL CDC4L CVID8 LAB300 LBA
UniProtKB ID: P50851, Q4W5J4, Q4W5L6, Q8NFQ0, Q9H2U3, Q9H2U4
Gene ID:
Human(987) Summary: The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(80877) LPS-responsive beige-like anchor
Rat(361975) LPS-responsive vesicle trafficking, beach and anchor containing
Zebrafish(100317557) LPS-responsive vesicle trafficking, beach and anchor containing
dog(475463) LPS-responsive vesicle trafficking, beach and anchor containing
domestic cat(101093432) LPS-responsive vesicle trafficking, beach and anchor containing
cow(524279) LPS-responsive vesicle trafficking, beach and anchor containing
Horse(100062459) LPS-responsive vesicle trafficking, beach and anchor containing
chicken(422476) LPS-responsive vesicle trafficking, beach and anchor containing
sheep(101106365) LPS-responsive vesicle trafficking, beach and anchor containing
domestic guinea pig(100721090) LPS-responsive vesicle trafficking, beach and anchor containing
naked mole-rat(101711663) LPS-responsive vesicle trafficking, beach and anchor containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006726 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030695 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030695 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030695 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006726 Rosetta Predictions human pricing
NM_001108555 Rosetta Predictions rat pricing
NM_001077687 Rosetta Predictions mouse pricing
NM_001077688 Rosetta Predictions mouse pricing
NM_030695 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126584 predicted 4372
2 SASI_Hs01_00126585 predicted 5209
3 SASI_Hs01_00126586 predicted 8564
4 SASI_Hs01_00126588 predicted 2032
5 SASI_Hs01_00126589 predicted 4647
6 SASI_Hs01_00126590 predicted 5451
7 SASI_Hs01_00126591 predicted 2227
8 SASI_Hs01_00126592 predicted 3194
9 SASI_Hs01_00126593 predicted 5988
10 SASI_Hs02_00342161 predicted 4492
11 SASI_Hs01_00126587 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239789 predicted 3969
2 SASI_Rn02_00239790 predicted 6795
3 SASI_Rn02_00239791 predicted 5350
4 SASI_Rn02_00239792 predicted 6866
5 SASI_Rn02_00239793 predicted 734
6 SASI_Rn02_00239794 predicted 690
7 SASI_Rn02_00239795 predicted 3865
8 SASI_Rn02_00239796 predicted 1855
9 SASI_Rn02_00239797 predicted 6235
10 SASI_Rn02_00239798 predicted 6410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292862 predicted 629
2 SASI_Mm02_00292863 predicted 5778
3 SASI_Mm02_00292864 predicted 4736
4 SASI_Mm02_00292865 predicted 7461
5 SASI_Mm02_00292866 predicted 7115
6 SASI_Mm02_00292867 predicted 5505
7 SASI_Mm02_00292868 predicted 4762
8 SASI_Mm02_00292869 predicted 6783
9 SASI_Mm02_00292870 predicted 720
10 SASI_Mm02_00292871 predicted 2350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292872 predicted 636
2 SASI_Mm02_00292873 predicted 5776
3 SASI_Mm02_00292874 predicted 4731
4 SASI_Mm02_00292875 predicted 7454
5 SASI_Mm02_00292876 predicted 7109
6 SASI_Mm02_00292877 predicted 5506
7 SASI_Mm02_00292878 predicted 4762
8 SASI_Mm02_00292879 predicted 6784
9 SASI_Mm02_00292880 predicted 719
10 SASI_Mm02_00292881 predicted 2352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336861 predicted 4752
2 SASI_Mm02_00336862 predicted 628
3 SASI_Mm01_00187288 predicted 5774
4 SASI_Mm01_00187289 predicted 4730
5 SASI_Mm01_00187290 predicted 7460
6 SASI_Mm01_00187291 predicted 5504
7 SASI_Mm02_00336863 predicted 4763
8 SASI_Mm01_00187292 predicted 6782
9 SASI_Mm01_00187293 predicted 718
10 SASI_Mm02_00336864 predicted 2352
11 SASI_Mm01_00187294 predicted 6698
12 SASI_Mm01_00187295 predicted 4324
13 SASI_Mm01_00187296 predicted 7818
14 SASI_Mm01_00187297 predicted 4474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006726
VALIDATED
LRBA MISSION shRNA Bacterial Glycerol Stock
LPS-responsive vesicle trafficking, beach and anchor containing
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006726.2-8795s21c1
Sequence:CCGGCCACGATGGAAACAGATGATACTCGAGTATCATCTGTTTCCATCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006726.2-9502s21c1
Sequence:CCGGCTGTGCTTCTTCAGCACTAATCTCGAGATTAGTGCTGAAGAAGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006726.2-1402s21c1
Sequence:CCGGCGATGGAAGAATAGTGAACTTCTCGAGAAGTTCACTATTCTTCCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006726.2-5807s21c1
Sequence:CCGGCCTCAGTTCCAACAGTTGATTCTCGAGAATCAACTGTTGGAACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006726.1-9272s1c1
Sequence:CCGGCTGTGCTTCTTCAGCACTAATCTCGAGATTAGTGCTGAAGAAGCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006726.1-9496s1c1
Sequence:CCGGGTCATCTTCATAGCACAACAACTCGAGTTGTTGTGCTATGAAGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006726.1-5966s1c1
Sequence:CCGGGCAGAAGATATTCACAGACATCTCGAGATGTCTGTGAATATCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006726.1-5577s1c1
Sequence:CCGGCCTCAGTTCCAACAGTTGATTCTCGAGAATCAACTGTTGGAACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006726.2-6196s21c1
Sequence:CCGGGCAGAAGATATTCACAGACATCTCGAGATGTCTGTGAATATCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006726.1-1172s1c1
Sequence:CCGGCGATGGAAGAATAGTGAACTTCTCGAGAAGTTCACTATTCTTCCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006726.1-8565s1c1
Sequence:CCGGCCACGATGGAAACAGATGATACTCGAGTATCATCTGTTTCCATCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006726
VALIDATED
LRBA MISSION shRNA shRNA Plasmid DNA
LPS-responsive vesicle trafficking, beach and anchor containing
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006726.2-8795s21c1
Sequence:CCGGCCACGATGGAAACAGATGATACTCGAGTATCATCTGTTTCCATCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006726.2-9502s21c1
Sequence:CCGGCTGTGCTTCTTCAGCACTAATCTCGAGATTAGTGCTGAAGAAGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006726.2-1402s21c1
Sequence:CCGGCGATGGAAGAATAGTGAACTTCTCGAGAAGTTCACTATTCTTCCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006726.2-5807s21c1
Sequence:CCGGCCTCAGTTCCAACAGTTGATTCTCGAGAATCAACTGTTGGAACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006726.1-9272s1c1
Sequence:CCGGCTGTGCTTCTTCAGCACTAATCTCGAGATTAGTGCTGAAGAAGCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006726.1-9496s1c1
Sequence:CCGGGTCATCTTCATAGCACAACAACTCGAGTTGTTGTGCTATGAAGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006726.1-5966s1c1
Sequence:CCGGGCAGAAGATATTCACAGACATCTCGAGATGTCTGTGAATATCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006726.1-5577s1c1
Sequence:CCGGCCTCAGTTCCAACAGTTGATTCTCGAGAATCAACTGTTGGAACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006726.2-6196s21c1
Sequence:CCGGGCAGAAGATATTCACAGACATCTCGAGATGTCTGTGAATATCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006726.1-1172s1c1
Sequence:CCGGCGATGGAAGAATAGTGAACTTCTCGAGAAGTTCACTATTCTTCCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006726.1-8565s1c1
Sequence:CCGGCCACGATGGAAACAGATGATACTCGAGTATCATCTGTTTCCATCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006726
VALIDATED
LRBA MISSION shRNA Lentiviral Transduction Particles
LPS-responsive vesicle trafficking, beach and anchor containing
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006726.2-8795s21c1
Sequence:CCGGCCACGATGGAAACAGATGATACTCGAGTATCATCTGTTTCCATCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006726.2-9502s21c1
Sequence:CCGGCTGTGCTTCTTCAGCACTAATCTCGAGATTAGTGCTGAAGAAGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006726.2-1402s21c1
Sequence:CCGGCGATGGAAGAATAGTGAACTTCTCGAGAAGTTCACTATTCTTCCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006726.2-5807s21c1
Sequence:CCGGCCTCAGTTCCAACAGTTGATTCTCGAGAATCAACTGTTGGAACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006726.1-9272s1c1
Sequence:CCGGCTGTGCTTCTTCAGCACTAATCTCGAGATTAGTGCTGAAGAAGCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006726.1-9496s1c1
Sequence:CCGGGTCATCTTCATAGCACAACAACTCGAGTTGTTGTGCTATGAAGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006726.1-5966s1c1
Sequence:CCGGGCAGAAGATATTCACAGACATCTCGAGATGTCTGTGAATATCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006726.1-5577s1c1
Sequence:CCGGCCTCAGTTCCAACAGTTGATTCTCGAGAATCAACTGTTGGAACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006726.2-6196s21c1
Sequence:CCGGGCAGAAGATATTCACAGACATCTCGAGATGTCTGTGAATATCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006726.1-1172s1c1
Sequence:CCGGCGATGGAAGAATAGTGAACTTCTCGAGAAGTTCACTATTCTTCCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006726.1-8565s1c1
Sequence:CCGGCCACGATGGAAACAGATGATACTCGAGTATCATCTGTTTCCATCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030695
LRBA MISSION shRNA Bacterial Glycerol Stock
LPS-responsive vesicle trafficking, beach and anchor containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030695.1-9730s1c1
Sequence:CCGGCCCTATTTGTTATGAAGCTATCTCGAGATAGCTTCATAACAAATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030695.1-786s1c1
Sequence:CCGGCCAGCTATAATTTGACAGTTACTCGAGTAACTGTCAAATTATAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030695.1-4888s1c1
Sequence:CCGGGCAAGCTCAATTCTTGGCTTTCTCGAGAAAGCCAAGAATTGAGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030695.1-7339s1c1
Sequence:CCGGGCGCGACACATCTGACATTAACTCGAGTTAATGTCAGATGTGTCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030695.1-535s1c1
Sequence:CCGGCCAGTTTGATTTGGAGATGAACTCGAGTTCATCTCCAAATCAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030695
LRBA MISSION shRNA shRNA Plasmid DNA
LPS-responsive vesicle trafficking, beach and anchor containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030695.1-9730s1c1
Sequence:CCGGCCCTATTTGTTATGAAGCTATCTCGAGATAGCTTCATAACAAATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030695.1-786s1c1
Sequence:CCGGCCAGCTATAATTTGACAGTTACTCGAGTAACTGTCAAATTATAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030695.1-4888s1c1
Sequence:CCGGGCAAGCTCAATTCTTGGCTTTCTCGAGAAAGCCAAGAATTGAGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030695.1-7339s1c1
Sequence:CCGGGCGCGACACATCTGACATTAACTCGAGTTAATGTCAGATGTGTCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030695.1-535s1c1
Sequence:CCGGCCAGTTTGATTTGGAGATGAACTCGAGTTCATCTCCAAATCAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030695
LRBA MISSION shRNA Lentiviral Transduction Particles
LPS-responsive vesicle trafficking, beach and anchor containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030695.1-9730s1c1
Sequence:CCGGCCCTATTTGTTATGAAGCTATCTCGAGATAGCTTCATAACAAATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030695.1-786s1c1
Sequence:CCGGCCAGCTATAATTTGACAGTTACTCGAGTAACTGTCAAATTATAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030695.1-4888s1c1
Sequence:CCGGGCAAGCTCAATTCTTGGCTTTCTCGAGAAAGCCAAGAATTGAGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030695.1-7339s1c1
Sequence:CCGGGCGCGACACATCTGACATTAACTCGAGTTAATGTCAGATGTGTCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030695.1-535s1c1
Sequence:CCGGCCAGTTTGATTTGGAGATGAACTCGAGTTCATCTCCAAATCAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)