EMAIL THIS PAGE TO A FRIEND

LRCH2

leucine-rich repeats and calponin homology (CH) domain containing 2

189 Gene Product Result for
Synonyms: dA204F4.4
UniProtKB ID: Q5VUJ6, F5H2T1, Q08AD5, Q9HA88, Q9P233
Gene ID:
Human(57631) Summary: This gene encodes a member of the leucine-rich repeat and calponin homology domain-containing protein family. These family members contain multiple N-terminal leucine-rich repeats, in addition to a C-terminal calponin homology domain, a type of domain that mediates interactions with actin filaments. These proteins are conserved across animal species, and studies of a similar Drosophila protein indicate a function as a cytoskeletal scaffolding protein. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Mouse(210297) leucine-rich repeats and calponin homology (CH) domain containing 2
Rat(680591) leucine-rich repeats and calponin homology (CH) domain containing 2
sheep(101109945) leucine-rich repeats and calponin homology (CH) domain containing 2
domestic guinea pig(100733114) leucine-rich repeats and calponin homology (CH) domain containing 2
naked mole-rat(101725315) leucine-rich repeats and calponin homology (CH) domain containing 2
Zebrafish(100150488) leucine-rich repeats and calponin homology (CH) domain containing 2
cow(100336559) leucine-rich repeats and calponin homology (CH) domain containing 2
cow(537991) leucine-rich repeats and calponin homology (CH) domain containing 2
Horse(100053980) leucine-rich repeats and calponin homology (CH) domain containing 2
domestic cat(101100373) leucine-rich repeats and calponin homology (CH) domain containing 2
dog(492078) leucine-rich repeats and calponin homology (CH) domain containing 2
chicken(422220) leucine-rich repeats and calponin homology (CH) domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003233 Anti-LRCH2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081173 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081173 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081173 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020871 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020871 Rosetta Predictions human pricing
XM_001057911 Rosetta Predictions rat pricing
NM_001081173 Rosetta Predictions mouse pricing
XM_204439 Rosetta Predictions mouse pricing
XM_897666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099146 predicted 2066
2 SASI_Hs01_00099147 predicted 1256
3 SASI_Hs01_00099148 predicted 858
4 SASI_Hs01_00099149 predicted 808
5 SASI_Hs01_00099150 predicted 1307
6 SASI_Hs01_00099151 predicted 1762
7 SASI_Hs02_00354167 predicted 2307
8 SASI_Hs02_00354168 predicted 788
9 SASI_Hs01_00099154 predicted 1093
10 SASI_Hs01_00099155 predicted 498
11 SASI_Hs01_00099152 predicted 1575
12 SASI_Hs01_00099153 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287953 predicted 1264
2 SASI_Rn02_00287954 predicted 1704
3 SASI_Rn02_00287955 predicted 338
4 SASI_Rn02_00287956 predicted 277
5 SASI_Rn02_00287957 predicted 427
6 SASI_Rn02_00287958 predicted 504
7 SASI_Rn02_00287959 predicted 554
8 SASI_Rn02_00287960 predicted 543
9 SASI_Rn02_00287961 predicted 456
10 SASI_Rn02_00287962 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295901 predicted 439
2 SASI_Mm02_00295902 predicted 834
3 SASI_Mm02_00295903 predicted 2086
4 SASI_Mm02_00295904 predicted 460
5 SASI_Mm02_00295905 predicted 1967
6 SASI_Mm02_00295906 predicted 920
7 SASI_Mm02_00295907 predicted 1992
8 SASI_Mm02_00295908 predicted 2374
9 SASI_Mm02_00295909 predicted 925
10 SASI_Mm02_00295910 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_204439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270936 predicted 2093
2 SASI_Mm01_00270937 predicted 1971
3 SASI_Mm01_00270938 predicted 1971
4 SASI_Mm01_00270939 predicted 1834
5 SASI_Mm01_00270940 predicted 1940
6 SASI_Mm01_00270941 predicted 1828
7 SASI_Mm01_00270942 predicted 1996
8 SASI_Mm01_00270943 predicted 1903
9 SASI_Mm01_00270944 predicted 1877
10 SASI_Mm01_00270945 predicted 2016
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238927 predicted 1988
2 SASI_Mm01_00238928 predicted 2010
3 SASI_Mm01_00238929 predicted 2169
4 SASI_Mm01_00238930 predicted 2049
5 SASI_Mm01_00238931 predicted 1968
6 SASI_Mm01_00238932 predicted 1969
7 SASI_Mm01_00238933 predicted 2142
8 SASI_Mm01_00238934 predicted 2130
9 SASI_Mm01_00238935 predicted 2053
10 SASI_Mm01_00238936 predicted 2004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081173
LRCH2 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and calponin homology (CH) domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081173.1-1675s21c1
Sequence:CCGGGCCAGAATCTCAGCCTATAATCTCGAGATTATAGGCTGAGATTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081173.1-3299s21c1
Sequence:CCGGACGTTTGGGTTCTTATCTAAACTCGAGTTTAGATAAGAACCCAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081173.1-2241s21c1
Sequence:CCGGTGTGCTTGCCTCACCATATTTCTCGAGAAATATGGTGAGGCAAGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081173.1-2000s21c1
Sequence:CCGGATAAGGCAGCTTCGCAATAATCTCGAGATTATTGCGAAGCTGCCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081173.1-628s21c1
Sequence:CCGGCGTATCCATTCCCGAAGAAATCTCGAGATTTCTTCGGGAATGGATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081173
LRCH2 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and calponin homology (CH) domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081173.1-1675s21c1
Sequence:CCGGGCCAGAATCTCAGCCTATAATCTCGAGATTATAGGCTGAGATTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081173.1-3299s21c1
Sequence:CCGGACGTTTGGGTTCTTATCTAAACTCGAGTTTAGATAAGAACCCAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081173.1-2241s21c1
Sequence:CCGGTGTGCTTGCCTCACCATATTTCTCGAGAAATATGGTGAGGCAAGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081173.1-2000s21c1
Sequence:CCGGATAAGGCAGCTTCGCAATAATCTCGAGATTATTGCGAAGCTGCCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081173.1-628s21c1
Sequence:CCGGCGTATCCATTCCCGAAGAAATCTCGAGATTTCTTCGGGAATGGATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081173
LRCH2 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and calponin homology (CH) domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081173.1-1675s21c1
Sequence:CCGGGCCAGAATCTCAGCCTATAATCTCGAGATTATAGGCTGAGATTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081173.1-3299s21c1
Sequence:CCGGACGTTTGGGTTCTTATCTAAACTCGAGTTTAGATAAGAACCCAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081173.1-2241s21c1
Sequence:CCGGTGTGCTTGCCTCACCATATTTCTCGAGAAATATGGTGAGGCAAGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081173.1-2000s21c1
Sequence:CCGGATAAGGCAGCTTCGCAATAATCTCGAGATTATTGCGAAGCTGCCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081173.1-628s21c1
Sequence:CCGGCGTATCCATTCCCGAAGAAATCTCGAGATTTCTTCGGGAATGGATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020871
VALIDATED
LRCH2 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and calponin homology (CH) domain containing 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020871.2-770s1c1
Sequence:CCGGCTTCCCTTAGTCAAGCTGGATCTCGAGATCCAGCTTGACTAAGGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020871.2-372s1c1
Sequence:CCGGCCCAAGCAGATCTTTCCAGAACTCGAGTTCTGGAAAGATCTGCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020871.2-1693s1c1
Sequence:CCGGGCGGAGCAAACAGATTAGAAACTCGAGTTTCTAATCTGTTTGCTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020871.2-1966s1c1
Sequence:CCGGGCGAGAGCAAATACGACAACTCTCGAGAGTTGTCGTATTTGCTCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020871.2-1967s1c1
Sequence:CCGGCGAGAGCAAATACGACAACTTCTCGAGAAGTTGTCGTATTTGCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020871.2-1481s1c1
Sequence:CCGGGAACAGAAGAACAGGATTCTTCTCGAGAAGAATCCTGTTCTTCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020871.2-510s1c1
Sequence:CCGGCATACCTTAACATTAGCCGAACTCGAGTTCGGCTAATGTTAAGGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020871.2-614s1c1
Sequence:CCGGCCAGAAGAAATTGGGAAGTTACTCGAGTAACTTCCCAATTTCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020871.2-3405s1c1
Sequence:CCGGGCCATTTGTGAATCCTGTAAACTCGAGTTTACAGGATTCACAAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020871.2-2915s1c1
Sequence:CCGGCCTGTGTAATTGATGACTCTTCTCGAGAAGAGTCATCAATTACACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020871.2-1460s1c1
Sequence:CCGGGCTGCTCAGTTATTGCAGCAACTCGAGTTGCTGCAATAACTGAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020871
VALIDATED
LRCH2 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and calponin homology (CH) domain containing 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020871.2-770s1c1
Sequence:CCGGCTTCCCTTAGTCAAGCTGGATCTCGAGATCCAGCTTGACTAAGGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020871.2-372s1c1
Sequence:CCGGCCCAAGCAGATCTTTCCAGAACTCGAGTTCTGGAAAGATCTGCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020871.2-1693s1c1
Sequence:CCGGGCGGAGCAAACAGATTAGAAACTCGAGTTTCTAATCTGTTTGCTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020871.2-1966s1c1
Sequence:CCGGGCGAGAGCAAATACGACAACTCTCGAGAGTTGTCGTATTTGCTCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020871.2-1967s1c1
Sequence:CCGGCGAGAGCAAATACGACAACTTCTCGAGAAGTTGTCGTATTTGCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020871.2-1481s1c1
Sequence:CCGGGAACAGAAGAACAGGATTCTTCTCGAGAAGAATCCTGTTCTTCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020871.2-510s1c1
Sequence:CCGGCATACCTTAACATTAGCCGAACTCGAGTTCGGCTAATGTTAAGGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020871.2-614s1c1
Sequence:CCGGCCAGAAGAAATTGGGAAGTTACTCGAGTAACTTCCCAATTTCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020871.2-3405s1c1
Sequence:CCGGGCCATTTGTGAATCCTGTAAACTCGAGTTTACAGGATTCACAAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020871.2-2915s1c1
Sequence:CCGGCCTGTGTAATTGATGACTCTTCTCGAGAAGAGTCATCAATTACACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020871.2-1460s1c1
Sequence:CCGGGCTGCTCAGTTATTGCAGCAACTCGAGTTGCTGCAATAACTGAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020871
VALIDATED
LRCH2 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and calponin homology (CH) domain containing 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020871.2-770s1c1
Sequence:CCGGCTTCCCTTAGTCAAGCTGGATCTCGAGATCCAGCTTGACTAAGGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020871.2-372s1c1
Sequence:CCGGCCCAAGCAGATCTTTCCAGAACTCGAGTTCTGGAAAGATCTGCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020871.2-1693s1c1
Sequence:CCGGGCGGAGCAAACAGATTAGAAACTCGAGTTTCTAATCTGTTTGCTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020871.2-1966s1c1
Sequence:CCGGGCGAGAGCAAATACGACAACTCTCGAGAGTTGTCGTATTTGCTCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020871.2-1967s1c1
Sequence:CCGGCGAGAGCAAATACGACAACTTCTCGAGAAGTTGTCGTATTTGCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020871.2-1481s1c1
Sequence:CCGGGAACAGAAGAACAGGATTCTTCTCGAGAAGAATCCTGTTCTTCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020871.2-510s1c1
Sequence:CCGGCATACCTTAACATTAGCCGAACTCGAGTTCGGCTAATGTTAAGGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020871.2-614s1c1
Sequence:CCGGCCAGAAGAAATTGGGAAGTTACTCGAGTAACTTCCCAATTTCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020871.2-3405s1c1
Sequence:CCGGGCCATTTGTGAATCCTGTAAACTCGAGTTTACAGGATTCACAAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_020871.2-2915s1c1
Sequence:CCGGCCTGTGTAATTGATGACTCTTCTCGAGAAGAGTCATCAATTACACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020871.2-1460s1c1
Sequence:CCGGGCTGCTCAGTTATTGCAGCAACTCGAGTTGCTGCAATAACTGAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)