EMAIL THIS PAGE TO A FRIEND

LRCH3

leucine-rich repeats and calponin homology (CH) domain containing 3

81 Gene Product Result for
UniProtKB ID: Q96II8, Q96FP9, Q9NT52
Gene ID:
Mouse(70144) leucine-rich repeats and calponin homology (CH) domain containing 3
Rat(303883) leucine-rich repeats and calponin homology (CH) domain containing 3
chicken(424922) leucine-rich repeats and calponin homology (CH) domain containing 3
cow(786557) leucine-rich repeats and calponin homology (CH) domain containing 3
Horse(100060425) leucine-rich repeats and calponin homology (CH) domain containing 3
domestic cat(101097582) leucine-rich repeats and calponin homology (CH) domain containing 3
dog(100687340) leucine-rich repeats and calponin homology (CH) domain containing 3
naked mole-rat(101705568) leucine-rich repeats and calponin homology (CH) domain containing 3
Domestic Rabbit(100343229) leucine-rich repeats and calponin homology (CH) domain containing 3
domestic guinea pig(100716573) leucine-rich repeats and calponin homology (CH) domain containing 3
sheep(101119355) leucine-rich repeats and calponin homology (CH) domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032773 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081255 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081255 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081255 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032773 Rosetta Predictions human pricing
NM_001107088 Rosetta Predictions rat pricing
NM_001081255 Rosetta Predictions mouse pricing
XM_619388 Rosetta Predictions mouse pricing
XM_901489 Rosetta Predictions mouse pricing
XM_901490 Rosetta Predictions mouse pricing
XM_901496 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074583 predicted 515
2 SASI_Hs01_00074585 predicted 1730
3 SASI_Hs02_00360310 predicted 1709
4 SASI_Hs01_00074586 predicted 536
5 SASI_Hs02_00360311 predicted 546
6 SASI_Hs01_00074587 predicted 802
7 SASI_Hs01_00074588 predicted 669
8 SASI_Hs01_00074589 predicted 291
9 SASI_Hs01_00074590 predicted 1120
10 SASI_Hs01_00074591 predicted 591
11 SASI_Hs01_00074584 predicted 1914
12 SASI_Hs01_00074592 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225376 predicted 937
2 SASI_Rn02_00225377 predicted 987
3 SASI_Rn02_00225378 predicted 673
4 SASI_Rn02_00225379 predicted 1363
5 SASI_Rn02_00225380 predicted 978
6 SASI_Rn02_00225381 predicted 627
7 SASI_Rn02_00225382 predicted 1390
8 SASI_Rn02_00225383 predicted 1682
9 SASI_Rn02_00225384 predicted 1602
10 SASI_Rn02_00225385 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081255 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296687 predicted 2010
2 SASI_Mm02_00296688 predicted 492
3 SASI_Mm02_00296689 predicted 374
4 SASI_Mm02_00296690 predicted 838
5 SASI_Mm02_00296691 predicted 1249
6 SASI_Mm02_00296692 predicted 1413
7 SASI_Mm02_00296693 predicted 646
8 SASI_Mm02_00296694 predicted 1618
9 SASI_Mm02_00296695 predicted 2065
10 SASI_Mm02_00296696 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279724 predicted 2015
2 SASI_Mm01_00279725 predicted 497
3 SASI_Mm01_00279726 predicted 370
4 SASI_Mm01_00279727 predicted 844
5 SASI_Mm01_00279728 predicted 1250
6 SASI_Mm01_00279729 predicted 1412
7 SASI_Mm01_00279730 predicted 657
8 SASI_Mm01_00279731 predicted 1618
9 SASI_Mm01_00279732 predicted 995
10 SASI_Mm01_00279733 predicted 1283
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207708 predicted 1712
2 SASI_Mm01_00207709 predicted 1116
3 SASI_Mm01_00207710 predicted 1674
4 SASI_Mm01_00207711 predicted 1320
5 SASI_Mm01_00207712 predicted 1781
6 SASI_Mm01_00207713 predicted 992
7 SASI_Mm01_00207714 predicted 1009
8 SASI_Mm01_00207715 predicted 1277
9 SASI_Mm01_00207716 predicted 1131
10 SASI_Mm01_00207717 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211727 predicted 495
2 SASI_Mm01_00211728 predicted 370
3 SASI_Mm01_00211729 predicted 840
4 SASI_Mm01_00211730 predicted 1250
5 SASI_Mm01_00211731 predicted 1417
6 SASI_Mm01_00211732 predicted 655
7 SASI_Mm01_00211733 predicted 985
8 SASI_Mm01_00211734 predicted 1059
9 SASI_Mm01_00211735 predicted 1284
10 SASI_Mm01_00211736 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216420 predicted 501
2 SASI_Mm01_00216421 predicted 693
3 SASI_Mm01_00216422 predicted 316
4 SASI_Mm01_00216423 predicted 372
5 SASI_Mm01_00216424 predicted 433
6 SASI_Mm01_00216425 predicted 377
7 SASI_Mm01_00216426 predicted 653
8 SASI_Mm01_00216427 predicted 574
9 SASI_Mm01_00216428 predicted 559
10 SASI_Mm01_00216429 predicted 513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032773
LRCH3 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and calponin homology (CH) domain containing 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032773.2-1916s1c1
Sequence:CCGGCACTGATTCTACAGATTCCATCTCGAGATGGAATCTGTAGAATCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032773.2-502s1c1
Sequence:CCGGCAGAAGAAATTGGACACCTTACTCGAGTAAGGTGTCCAATTTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032773.2-1758s1c1
Sequence:CCGGGCAACAGAAACAGTTCATCATCTCGAGATGATGAACTGTTTCTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032773.2-1978s21c1
Sequence:CCGGTAATAGACCAACTGCGTAAACCTCGAGGTTTACGCAGTTGGTCTATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032773.2-1729s21c1
Sequence:CCGGACAGACCTAATGCTCTATTAACTCGAGTTAATAGAGCATTAGGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032773.2-735s21c1
Sequence:CCGGCAGACGATCACCCTAGATAACCTCGAGGTTATCTAGGGTGATCGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032773.2-1017s21c1
Sequence:CCGGCGAGTAGCAGAGATTACTAAACTCGAGTTTAGTAATCTCTGCTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032773.2-1212s21c1
Sequence:CCGGTCACAGTTTATGGCGTATATTCTCGAGAATATACGCCATAAACTGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032773
LRCH3 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and calponin homology (CH) domain containing 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032773.2-1916s1c1
Sequence:CCGGCACTGATTCTACAGATTCCATCTCGAGATGGAATCTGTAGAATCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032773.2-502s1c1
Sequence:CCGGCAGAAGAAATTGGACACCTTACTCGAGTAAGGTGTCCAATTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032773.2-1758s1c1
Sequence:CCGGGCAACAGAAACAGTTCATCATCTCGAGATGATGAACTGTTTCTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032773.2-1978s21c1
Sequence:CCGGTAATAGACCAACTGCGTAAACCTCGAGGTTTACGCAGTTGGTCTATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032773.2-1729s21c1
Sequence:CCGGACAGACCTAATGCTCTATTAACTCGAGTTAATAGAGCATTAGGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032773.2-735s21c1
Sequence:CCGGCAGACGATCACCCTAGATAACCTCGAGGTTATCTAGGGTGATCGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032773.2-1017s21c1
Sequence:CCGGCGAGTAGCAGAGATTACTAAACTCGAGTTTAGTAATCTCTGCTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032773.2-1212s21c1
Sequence:CCGGTCACAGTTTATGGCGTATATTCTCGAGAATATACGCCATAAACTGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032773
LRCH3 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and calponin homology (CH) domain containing 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032773.2-1916s1c1
Sequence:CCGGCACTGATTCTACAGATTCCATCTCGAGATGGAATCTGTAGAATCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032773.2-502s1c1
Sequence:CCGGCAGAAGAAATTGGACACCTTACTCGAGTAAGGTGTCCAATTTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032773.2-1758s1c1
Sequence:CCGGGCAACAGAAACAGTTCATCATCTCGAGATGATGAACTGTTTCTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032773.2-1978s21c1
Sequence:CCGGTAATAGACCAACTGCGTAAACCTCGAGGTTTACGCAGTTGGTCTATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032773.2-1729s21c1
Sequence:CCGGACAGACCTAATGCTCTATTAACTCGAGTTAATAGAGCATTAGGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032773.2-735s21c1
Sequence:CCGGCAGACGATCACCCTAGATAACCTCGAGGTTATCTAGGGTGATCGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032773.2-1017s21c1
Sequence:CCGGCGAGTAGCAGAGATTACTAAACTCGAGTTTAGTAATCTCTGCTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032773.2-1212s21c1
Sequence:CCGGTCACAGTTTATGGCGTATATTCTCGAGAATATACGCCATAAACTGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081255
VALIDATED
LRCH3 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and calponin homology (CH) domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081255.1-4821s21c1
Sequence:CCGGGACAACTCATTTGGATATTTACTCGAGTAAATATCCAAATGAGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081255.1-881s21c1
Sequence:CCGGCTCCAGATCTGCCAGATTATGCTCGAGCATAATCTGGCAGATCTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081255.1-1947s21c1
Sequence:CCGGTGATCCTACAGATGCTATAACCTCGAGGTTATAGCATCTGTAGGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081255.1-382s21c1
Sequence:CCGGCAGAATTGTATTCGGTATATCCTCGAGGATATACCGAATACAATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081255.1-707s21c1
Sequence:CCGGGGCTCGACTTCTCGTGCAATACTCGAGTATTGCACGAGAAGTCGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081255
VALIDATED
LRCH3 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and calponin homology (CH) domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081255.1-4821s21c1
Sequence:CCGGGACAACTCATTTGGATATTTACTCGAGTAAATATCCAAATGAGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081255.1-881s21c1
Sequence:CCGGCTCCAGATCTGCCAGATTATGCTCGAGCATAATCTGGCAGATCTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081255.1-1947s21c1
Sequence:CCGGTGATCCTACAGATGCTATAACCTCGAGGTTATAGCATCTGTAGGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081255.1-382s21c1
Sequence:CCGGCAGAATTGTATTCGGTATATCCTCGAGGATATACCGAATACAATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081255.1-707s21c1
Sequence:CCGGGGCTCGACTTCTCGTGCAATACTCGAGTATTGCACGAGAAGTCGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081255
VALIDATED
LRCH3 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and calponin homology (CH) domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081255.1-4821s21c1
Sequence:CCGGGACAACTCATTTGGATATTTACTCGAGTAAATATCCAAATGAGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081255.1-881s21c1
Sequence:CCGGCTCCAGATCTGCCAGATTATGCTCGAGCATAATCTGGCAGATCTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081255.1-1947s21c1
Sequence:CCGGTGATCCTACAGATGCTATAACCTCGAGGTTATAGCATCTGTAGGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081255.1-382s21c1
Sequence:CCGGCAGAATTGTATTCGGTATATCCTCGAGGATATACCGAATACAATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081255.1-707s21c1
Sequence:CCGGGGCTCGACTTCTCGTGCAATACTCGAGTATTGCACGAGAAGTCGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)