EMAIL THIS PAGE TO A FRIEND

LRCH4

leucine-rich repeats and calponin homology (CH) domain containing 4

66 Gene Product Result for
Synonyms: LRN LRRN1 LRRN4 PP14183
UniProtKB ID: O75427, A4D2D5, Q8WV85, Q96ID0
Gene ID:
Human(4034) Summary: This gene encodes a protein that contains leucine-rich repeats (LRR) at its amino terminus and that is known to be involved in ligand binding. The carboxyl terminus may act as a membrane anchor. Identified structural elements suggest that the encoded protein resembles a receptor. [provided by RefSeq, Jul 2008]
Mouse(231798) leucine-rich repeats and calponin homology (CH) domain containing 4
Rat(360779) leucine-rich repeats and calponin homology (CH) domain containing 4
sheep(101121395) leucine-rich repeats and calponin homology (CH) domain containing 4
domestic guinea pig(100722259) leucine-rich repeats and calponin homology (CH) domain containing 4
Domestic Rabbit(100358516) leucine-rich repeats and calponin homology (CH) domain containing 4
naked mole-rat(101717141) leucine-rich repeats and calponin homology (CH) domain containing 4
Zebrafish(100003333) leucine-rich repeats and calponin homology (CH) domain containing 4
dog(489836) leucine-rich repeats and calponin homology (CH) domain containing 4
domestic cat(101091329) leucine-rich repeats and calponin homology (CH) domain containing 4
cow(527134) leucine-rich repeats and calponin homology (CH) domain containing 4
Horse(100067371) leucine-rich repeats and calponin homology (CH) domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146164 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146164 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146164 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002319 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU091551 MISSION® esiRNA esiRNA targeting mouse Lrch4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002319 Rosetta Predictions human pricing
NM_001127551 Rosetta Predictions rat pricing
NM_146164 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189158 predicted 1533
2 SASI_Hs01_00189159 predicted 1834
3 SASI_Hs01_00189161 predicted 665
4 SASI_Hs01_00189162 predicted 1105
5 SASI_Hs02_00333645 predicted 961
6 SASI_Hs01_00189163 predicted 236
7 SASI_Hs01_00189165 predicted 1329
8 SASI_Hs01_00189166 predicted 558
9 SASI_Hs01_00189167 predicted 1394
10 SASI_Hs02_00333646 predicted 1017
11 SASI_Hs01_00189160 predicted 809
12 SASI_Hs01_00189164 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254263 predicted 662
2 SASI_Rn02_00254264 predicted 1079
3 SASI_Rn02_00254265 predicted 1836
4 SASI_Rn02_00254266 predicted 221
5 SASI_Rn02_00254267 predicted 1850
6 SASI_Rn02_00254268 predicted 2178
7 SASI_Rn02_00254269 predicted 1855
8 SASI_Rn02_00254270 predicted 718
9 SASI_Rn02_00254271 predicted 248
10 SASI_Rn02_00254272 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146164 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123113 predicted 1830
2 SASI_Mm01_00123114 predicted 432
3 SASI_Mm01_00123115 predicted 962
4 SASI_Mm01_00123116 predicted 211
5 SASI_Mm01_00123117 predicted 1635
6 SASI_Mm01_00123118 predicted 243
7 SASI_Mm01_00123119 predicted 1472
8 SASI_Mm01_00123120 predicted 477
9 SASI_Mm01_00123121 predicted 1800
10 SASI_Mm02_00341859 predicted 1047
11 SASI_Mm01_00123112 predicted 1830
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146164
VALIDATED
LRCH4 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and calponin homology (CH) domain containing 4
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146164.1-1073s21c1
Sequence:CCGGACCTGGAGCAGATTGACTTTACTCGAGTAAAGTCAATCTGCTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146164.1-2129s21c1
Sequence:CCGGTGCCTTCAGCCCTACCAAAGACTCGAGTCTTTGGTAGGGCTGAAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146164.1-784s21c1
Sequence:CCGGATCTTCAAGTACCTAACAATGCTCGAGCATTGTTAGGTACTTGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146164.1-1620s21c1
Sequence:CCGGTCAGGAGAAGGAGCTAATATCCTCGAGGATATTAGCTCCTTCTCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146164.1-317s21c1
Sequence:CCGGTCTACCACAATTGCCTGAAATCTCGAGATTTCAGGCAATTGTGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146164.1-867s21c1
Sequence:CCGGTCCTTGCCCTGCCGAAGATTTCTCGAGAAATCTTCGGCAGGGCAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146164.1-444s1c1
Sequence:CCGGGCTTATCATCAGCAACAACAACTCGAGTTGTTGTTGCTGATGATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146164.1-1150s1c1
Sequence:CCGGCCTTCTGAATTAAGCCTTGTACTCGAGTACAAGGCTTAATTCAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146164.1-2186s1c1
Sequence:CCGGCCCACTCTCATACCCACAATACTCGAGTATTGTGGGTATGAGAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146164.1-1804s1c1
Sequence:CCGGGCTCTCAAGTCTCGGAAGAATCTCGAGATTCTTCCGAGACTTGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146164.1-1149s1c1
Sequence:CCGGGCCTTCTGAATTAAGCCTTGTCTCGAGACAAGGCTTAATTCAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146164.1-2223s21c1
Sequence:CCGGTGATGGTGCCTTCGTGTTCTCCTCGAGGAGAACACGAAGGCACCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146164
VALIDATED
LRCH4 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and calponin homology (CH) domain containing 4
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146164.1-1073s21c1
Sequence:CCGGACCTGGAGCAGATTGACTTTACTCGAGTAAAGTCAATCTGCTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146164.1-2129s21c1
Sequence:CCGGTGCCTTCAGCCCTACCAAAGACTCGAGTCTTTGGTAGGGCTGAAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146164.1-784s21c1
Sequence:CCGGATCTTCAAGTACCTAACAATGCTCGAGCATTGTTAGGTACTTGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146164.1-1620s21c1
Sequence:CCGGTCAGGAGAAGGAGCTAATATCCTCGAGGATATTAGCTCCTTCTCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146164.1-317s21c1
Sequence:CCGGTCTACCACAATTGCCTGAAATCTCGAGATTTCAGGCAATTGTGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146164.1-867s21c1
Sequence:CCGGTCCTTGCCCTGCCGAAGATTTCTCGAGAAATCTTCGGCAGGGCAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146164.1-444s1c1
Sequence:CCGGGCTTATCATCAGCAACAACAACTCGAGTTGTTGTTGCTGATGATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146164.1-1150s1c1
Sequence:CCGGCCTTCTGAATTAAGCCTTGTACTCGAGTACAAGGCTTAATTCAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146164.1-2186s1c1
Sequence:CCGGCCCACTCTCATACCCACAATACTCGAGTATTGTGGGTATGAGAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146164.1-1804s1c1
Sequence:CCGGGCTCTCAAGTCTCGGAAGAATCTCGAGATTCTTCCGAGACTTGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146164.1-1149s1c1
Sequence:CCGGGCCTTCTGAATTAAGCCTTGTCTCGAGACAAGGCTTAATTCAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146164.1-2223s21c1
Sequence:CCGGTGATGGTGCCTTCGTGTTCTCCTCGAGGAGAACACGAAGGCACCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146164
VALIDATED
LRCH4 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and calponin homology (CH) domain containing 4
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146164.1-1073s21c1
Sequence:CCGGACCTGGAGCAGATTGACTTTACTCGAGTAAAGTCAATCTGCTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146164.1-2129s21c1
Sequence:CCGGTGCCTTCAGCCCTACCAAAGACTCGAGTCTTTGGTAGGGCTGAAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146164.1-784s21c1
Sequence:CCGGATCTTCAAGTACCTAACAATGCTCGAGCATTGTTAGGTACTTGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146164.1-1620s21c1
Sequence:CCGGTCAGGAGAAGGAGCTAATATCCTCGAGGATATTAGCTCCTTCTCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146164.1-317s21c1
Sequence:CCGGTCTACCACAATTGCCTGAAATCTCGAGATTTCAGGCAATTGTGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146164.1-867s21c1
Sequence:CCGGTCCTTGCCCTGCCGAAGATTTCTCGAGAAATCTTCGGCAGGGCAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146164.1-444s1c1
Sequence:CCGGGCTTATCATCAGCAACAACAACTCGAGTTGTTGTTGCTGATGATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146164.1-1150s1c1
Sequence:CCGGCCTTCTGAATTAAGCCTTGTACTCGAGTACAAGGCTTAATTCAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146164.1-2186s1c1
Sequence:CCGGCCCACTCTCATACCCACAATACTCGAGTATTGTGGGTATGAGAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146164.1-1804s1c1
Sequence:CCGGGCTCTCAAGTCTCGGAAGAATCTCGAGATTCTTCCGAGACTTGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146164.1-1149s1c1
Sequence:CCGGGCCTTCTGAATTAAGCCTTGTCTCGAGACAAGGCTTAATTCAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146164.1-2223s21c1
Sequence:CCGGTGATGGTGCCTTCGTGTTCTCCTCGAGGAGAACACGAAGGCACCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002319
VALIDATED
LRCH4 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and calponin homology (CH) domain containing 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002319.3-1171s21c1
Sequence:CCGGAGCAGCGACCACCCGAATTAACTCGAGTTAATTCGGGTGGTCGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002319.3-901s21c1
Sequence:CCGGGCCCTGCAGAGGATCTATTTCCTCGAGGAAATAGATCCTCTGCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002319.3-1655s21c1
Sequence:CCGGTCCAGATGAGAAGGACTTAATCTCGAGATTAAGTCCTTCTCATCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002319.3-337s21c1
Sequence:CCGGGCCTGAGCCTCTACCACAATTCTCGAGAATTGTGGTAGAGGCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002319.2-1569s1c1
Sequence:CCGGGAGACCAAACAGCTTCCTCTTCTCGAGAAGAGGAAGCTGTTTGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002319.2-919s1c1
Sequence:CCGGGAGGATCTATTTCCGGGACATCTCGAGATGTCCCGGAAATAGATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002319.2-1347s1c1
Sequence:CCGGGAGGAAGGATAGCCTCTTGAACTCGAGTTCAAGAGGCTATCCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002319.2-1862s1c1
Sequence:CCGGCTCGGAAGAATGTGGAGAGTTCTCGAGAACTCTCCACATTCTTCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002319.2-684s1c1
Sequence:CCGGCCGCCTGGATTTCTCCTGTAACTCGAGTTACAGGAGAAATCCAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002319.3-953s21c1
Sequence:CCGGAGGCTTCCACAGCGTTGATAGCTCGAGCTATCAACGCTGTGGAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002319
VALIDATED
LRCH4 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and calponin homology (CH) domain containing 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002319.3-1171s21c1
Sequence:CCGGAGCAGCGACCACCCGAATTAACTCGAGTTAATTCGGGTGGTCGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002319.3-901s21c1
Sequence:CCGGGCCCTGCAGAGGATCTATTTCCTCGAGGAAATAGATCCTCTGCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002319.3-1655s21c1
Sequence:CCGGTCCAGATGAGAAGGACTTAATCTCGAGATTAAGTCCTTCTCATCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002319.3-337s21c1
Sequence:CCGGGCCTGAGCCTCTACCACAATTCTCGAGAATTGTGGTAGAGGCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002319.2-1569s1c1
Sequence:CCGGGAGACCAAACAGCTTCCTCTTCTCGAGAAGAGGAAGCTGTTTGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002319.2-919s1c1
Sequence:CCGGGAGGATCTATTTCCGGGACATCTCGAGATGTCCCGGAAATAGATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002319.2-1347s1c1
Sequence:CCGGGAGGAAGGATAGCCTCTTGAACTCGAGTTCAAGAGGCTATCCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002319.2-1862s1c1
Sequence:CCGGCTCGGAAGAATGTGGAGAGTTCTCGAGAACTCTCCACATTCTTCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002319.2-684s1c1
Sequence:CCGGCCGCCTGGATTTCTCCTGTAACTCGAGTTACAGGAGAAATCCAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002319.3-953s21c1
Sequence:CCGGAGGCTTCCACAGCGTTGATAGCTCGAGCTATCAACGCTGTGGAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002319
VALIDATED
LRCH4 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and calponin homology (CH) domain containing 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002319.3-1171s21c1
Sequence:CCGGAGCAGCGACCACCCGAATTAACTCGAGTTAATTCGGGTGGTCGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002319.3-901s21c1
Sequence:CCGGGCCCTGCAGAGGATCTATTTCCTCGAGGAAATAGATCCTCTGCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002319.3-1655s21c1
Sequence:CCGGTCCAGATGAGAAGGACTTAATCTCGAGATTAAGTCCTTCTCATCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002319.3-337s21c1
Sequence:CCGGGCCTGAGCCTCTACCACAATTCTCGAGAATTGTGGTAGAGGCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002319.2-1569s1c1
Sequence:CCGGGAGACCAAACAGCTTCCTCTTCTCGAGAAGAGGAAGCTGTTTGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002319.2-919s1c1
Sequence:CCGGGAGGATCTATTTCCGGGACATCTCGAGATGTCCCGGAAATAGATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002319.2-1347s1c1
Sequence:CCGGGAGGAAGGATAGCCTCTTGAACTCGAGTTCAAGAGGCTATCCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002319.2-1862s1c1
Sequence:CCGGCTCGGAAGAATGTGGAGAGTTCTCGAGAACTCTCCACATTCTTCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002319.2-684s1c1
Sequence:CCGGCCGCCTGGATTTCTCCTGTAACTCGAGTTACAGGAGAAATCCAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002319.3-953s21c1
Sequence:CCGGAGGCTTCCACAGCGTTGATAGCTCGAGCTATCAACGCTGTGGAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)