EMAIL THIS PAGE TO A FRIEND

LRCOL1

leucine rich colipase-like 1

13 Gene Product Result for
UniProtKB ID: A6NCL2, H9BFB1
Gene ID:
Mouse(381667) leucine rich colipase-like 1
Rat(100363238) leucine rich colipase-like 1
dog(100686624) leucine rich colipase-like 1
naked mole-rat(101703560) leucine rich colipase-like 1
domestic guinea pig(100729295) leucine rich colipase-like 1
sheep(101116679) leucine rich colipase-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033459 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033459 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033459 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU190281 MISSION® esiRNA esiRNA targeting mouse Gm1679 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033459 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097410 predicted 296
2 SASI_Mm01_00097411 predicted 233
3 SASI_Mm01_00097412 predicted 232
4 SASI_Mm01_00097413 predicted 466
5 SASI_Mm01_00097414 predicted 456
6 SASI_Mm01_00097415 predicted 329
7 SASI_Mm01_00097416 predicted 217
8 SASI_Mm01_00097417 predicted 221
9 SASI_Mm01_00097418 predicted 342
10 SASI_Mm01_00097419 predicted 325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033459
LRCOL1 MISSION shRNA Bacterial Glycerol Stock
leucine rich colipase-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033459.2-271s21c1
Sequence:CCGGGACAGGTTCTGCTCATCAAAGCTCGAGCTTTGATGAGCAGAACCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033459.2-339s21c1
Sequence:CCGGATGCCAACACCACCTTGAATGCTCGAGCATTCAAGGTGGTGTTGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033459.2-131s21c1
Sequence:CCGGACAGCTTGAACCCACAGAAATCTCGAGATTTCTGTGGGTTCAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033459.2-488s21c1
Sequence:CCGGTGGACTTCAGAGACCAGAAAGCTCGAGCTTTCTGGTCTCTGAAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033459.2-293s21c1
Sequence:CCGGCCATCTTCATGCAGTGTATATCTCGAGATATACACTGCATGAAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033459
LRCOL1 MISSION shRNA shRNA Plasmid DNA
leucine rich colipase-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033459.2-271s21c1
Sequence:CCGGGACAGGTTCTGCTCATCAAAGCTCGAGCTTTGATGAGCAGAACCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033459.2-339s21c1
Sequence:CCGGATGCCAACACCACCTTGAATGCTCGAGCATTCAAGGTGGTGTTGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033459.2-131s21c1
Sequence:CCGGACAGCTTGAACCCACAGAAATCTCGAGATTTCTGTGGGTTCAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033459.2-488s21c1
Sequence:CCGGTGGACTTCAGAGACCAGAAAGCTCGAGCTTTCTGGTCTCTGAAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033459.2-293s21c1
Sequence:CCGGCCATCTTCATGCAGTGTATATCTCGAGATATACACTGCATGAAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033459
LRCOL1 MISSION shRNA Lentiviral Transduction Particles
leucine rich colipase-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033459.2-271s21c1
Sequence:CCGGGACAGGTTCTGCTCATCAAAGCTCGAGCTTTGATGAGCAGAACCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033459.2-339s21c1
Sequence:CCGGATGCCAACACCACCTTGAATGCTCGAGCATTCAAGGTGGTGTTGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033459.2-131s21c1
Sequence:CCGGACAGCTTGAACCCACAGAAATCTCGAGATTTCTGTGGGTTCAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033459.2-488s21c1
Sequence:CCGGTGGACTTCAGAGACCAGAAAGCTCGAGCTTTCTGGTCTCTGAAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033459.2-293s21c1
Sequence:CCGGCCATCTTCATGCAGTGTATATCTCGAGATATACACTGCATGAAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)