EMAIL THIS PAGE TO A FRIEND

LRFN1

leucine rich repeat and fibronectin type III domain containing 1

107 Gene Product Result for
Synonyms: SALM2
UniProtKB ID: Q9P244, Q8TBS9
Gene ID:
Mouse(80749) leucine rich repeat and fibronectin type III domain containing 1
Rat(365222) leucine rich repeat and fibronectin type III domain containing 1
domestic guinea pig(100712816) leucine rich repeat and fibronectin type III domain containing 1
naked mole-rat(101721421) leucine rich repeat and fibronectin type III domain containing 1
sheep(101116422) leucine rich repeat and fibronectin type III domain containing 1
domestic cat(101091241) leucine rich repeat and fibronectin type III domain containing 1
dog(484512) leucine rich repeat and fibronectin type III domain containing 1
cow(100301431) leucine rich repeat and fibronectin type III domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1400660 Anti-LRFN1 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB3500014 Anti-LRFN1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1677 Human SALM2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_290842 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_290842 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_290842 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020862 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030562 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030562 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030562 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020862 Rosetta Predictions human pricing
XM_290842 Rosetta Predictions human pricing
NM_001108910 Rosetta Predictions rat pricing
NM_001127694 Rosetta Predictions rat pricing
NM_030562 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354135 predicted 1240
2 SASI_Hs02_00354136 predicted 1422
3 SASI_Hs02_00354137 predicted 2129
4 SASI_Hs02_00354138 predicted 1350
5 SASI_Hs02_00354139 predicted 1664
6 SASI_Hs02_00354140 predicted 1381
7 SASI_Hs02_00354141 predicted 1650
8 SASI_Hs02_00354142 predicted 1149
9 SASI_Hs02_00354143 predicted 1581
10 SASI_Hs02_00354144 predicted 1358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261933 predicted 1246
2 SASI_Hs01_00261934 predicted 1423
3 SASI_Hs01_00261935 predicted 1085
4 SASI_Hs01_00261936 predicted 2131
5 SASI_Hs01_00261937 predicted 1351
6 SASI_Hs01_00261938 predicted 1676
7 SASI_Hs01_00261939 predicted 1385
8 SASI_Hs01_00261940 predicted 1655
9 SASI_Hs01_00261941 predicted 1158
10 SASI_Hs01_00261942 predicted 1583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243295 predicted 1256
2 SASI_Rn02_00243296 predicted 587
3 SASI_Rn02_00243297 predicted 556
4 SASI_Rn02_00243298 predicted 435
5 SASI_Rn02_00243299 predicted 964
6 SASI_Rn02_00243300 predicted 403
7 SASI_Rn02_00243301 predicted 932
8 SASI_Rn02_00243302 predicted 428
9 SASI_Rn02_00243303 predicted 654
10 SASI_Rn02_00243304 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254900 predicted 1131
2 SASI_Rn02_00254901 predicted 462
3 SASI_Rn02_00254902 predicted 433
4 SASI_Rn02_00254903 predicted 303
5 SASI_Rn02_00254904 predicted 835
6 SASI_Rn02_00254905 predicted 270
7 SASI_Rn02_00254906 predicted 801
8 SASI_Rn02_00254907 predicted 302
9 SASI_Rn02_00254908 predicted 529
10 SASI_Rn02_00254909 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114481 predicted 766
2 SASI_Mm01_00114482 predicted 590
3 SASI_Mm01_00114483 predicted 277
4 SASI_Mm01_00114484 predicted 985
5 SASI_Mm01_00114485 predicted 249
6 SASI_Mm01_00114486 predicted 964
7 SASI_Mm01_00114487 predicted 397
8 SASI_Mm01_00114488 predicted 319
9 SASI_Mm01_00114489 predicted 431
10 SASI_Mm01_00114490 predicted 670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_290842
VALIDATED
LRFN1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and fibronectin type III domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290842.2-1101s1c1
Sequence:CCGGCTTCACTTGTATCGCCTCCAACTCGAGTTGGAGGCGATACAAGTGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:XM_290842.2-3098s1c1
Sequence:CCGGGCCGCAGCAGAATTAAACTTTCTCGAGAAAGTTTAATTCTGCTGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290842.2-846s1c1
Sequence:CCGGCGACCGCTACTTCTGGTCCATCTCGAGATGGACCAGAAGTAGCGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:XM_290842.2-1657s1c1
Sequence:CCGGGTTCTGCTCATGATCCGCTATCTCGAGATAGCGGATCATGAGCAGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_290842.2-426s1c1
Sequence:CCGGGATCCTTGGAAACAACCAGATCTCGAGATCTGGTTGTTTCCAAGGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_290842
VALIDATED
LRFN1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and fibronectin type III domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290842.2-1101s1c1
Sequence:CCGGCTTCACTTGTATCGCCTCCAACTCGAGTTGGAGGCGATACAAGTGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:XM_290842.2-3098s1c1
Sequence:CCGGGCCGCAGCAGAATTAAACTTTCTCGAGAAAGTTTAATTCTGCTGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290842.2-846s1c1
Sequence:CCGGCGACCGCTACTTCTGGTCCATCTCGAGATGGACCAGAAGTAGCGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:XM_290842.2-1657s1c1
Sequence:CCGGGTTCTGCTCATGATCCGCTATCTCGAGATAGCGGATCATGAGCAGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_290842.2-426s1c1
Sequence:CCGGGATCCTTGGAAACAACCAGATCTCGAGATCTGGTTGTTTCCAAGGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_290842
VALIDATED
LRFN1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and fibronectin type III domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290842.2-1101s1c1
Sequence:CCGGCTTCACTTGTATCGCCTCCAACTCGAGTTGGAGGCGATACAAGTGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:XM_290842.2-3098s1c1
Sequence:CCGGGCCGCAGCAGAATTAAACTTTCTCGAGAAAGTTTAATTCTGCTGCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290842.2-846s1c1
Sequence:CCGGCGACCGCTACTTCTGGTCCATCTCGAGATGGACCAGAAGTAGCGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:XM_290842.2-1657s1c1
Sequence:CCGGGTTCTGCTCATGATCCGCTATCTCGAGATAGCGGATCATGAGCAGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_290842.2-426s1c1
Sequence:CCGGGATCCTTGGAAACAACCAGATCTCGAGATCTGGTTGTTTCCAAGGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020862
VALIDATED
LRFN1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and fibronectin type III domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020862.1-2721s21c1
Sequence:CCGGCTGGCTGGACTAGATCCTATTCTCGAGAATAGGATCTAGTCCAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020862.1-546s21c1
Sequence:CCGGGGGCCAGATGGTGAACCTAAACTCGAGTTTAGGTTCACCATCTGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020862.1-2137s21c1
Sequence:CCGGCTATTCCAGAGCCACAGTTACCTCGAGGTAACTGTGGCTCTGGAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020862.1-1657s21c1
Sequence:CCGGGTTCTGCTCATGATCCGCTATCTCGAGATAGCGGATCATGAGCAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020862.1-652s21c1
Sequence:CCGGACCTCCAACCGCCTGCATAAACTCGAGTTTATGCAGGCGGTTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020862
VALIDATED
LRFN1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and fibronectin type III domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020862.1-2721s21c1
Sequence:CCGGCTGGCTGGACTAGATCCTATTCTCGAGAATAGGATCTAGTCCAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020862.1-546s21c1
Sequence:CCGGGGGCCAGATGGTGAACCTAAACTCGAGTTTAGGTTCACCATCTGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020862.1-2137s21c1
Sequence:CCGGCTATTCCAGAGCCACAGTTACCTCGAGGTAACTGTGGCTCTGGAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020862.1-1657s21c1
Sequence:CCGGGTTCTGCTCATGATCCGCTATCTCGAGATAGCGGATCATGAGCAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020862.1-652s21c1
Sequence:CCGGACCTCCAACCGCCTGCATAAACTCGAGTTTATGCAGGCGGTTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020862
VALIDATED
LRFN1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and fibronectin type III domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020862.1-2721s21c1
Sequence:CCGGCTGGCTGGACTAGATCCTATTCTCGAGAATAGGATCTAGTCCAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020862.1-546s21c1
Sequence:CCGGGGGCCAGATGGTGAACCTAAACTCGAGTTTAGGTTCACCATCTGGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020862.1-2137s21c1
Sequence:CCGGCTATTCCAGAGCCACAGTTACCTCGAGGTAACTGTGGCTCTGGAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020862.1-1657s21c1
Sequence:CCGGGTTCTGCTCATGATCCGCTATCTCGAGATAGCGGATCATGAGCAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020862.1-652s21c1
Sequence:CCGGACCTCCAACCGCCTGCATAAACTCGAGTTTATGCAGGCGGTTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030562
LRFN1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and fibronectin type III domain containing 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030562.2-830s21c1
Sequence:CCGGGACCTCCAACCGTCTACATAACTCGAGTTATGTAGACGGTTGGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030562.2-1017s21c1
Sequence:CCGGCATCTCACTGACCGCTATTTCCTCGAGGAAATAGCGGTCAGTGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030562.2-422s21c1
Sequence:CCGGTCGTCGAGACTTCGCCAATATCTCGAGATATTGGCGAAGTCTCGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030562.2-601s21c1
Sequence:CCGGACTTGATCCTCGGCAACAATCCTCGAGGATTGTTGCCGAGGATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030562.2-763s21c1
Sequence:CCGGACAACCTCATTGATCACATTGCTCGAGCAATGTGATCAATGAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030562.1-709s1c1
Sequence:CCGGCACAACCTCATTGATCACATTCTCGAGAATGTGATCAATGAGGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030562.1-1489s1c1
Sequence:CCGGCAAGTGCAATACAACAGCTCTCTCGAGAGAGCTGTTGTATTGCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030562
LRFN1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and fibronectin type III domain containing 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030562.2-830s21c1
Sequence:CCGGGACCTCCAACCGTCTACATAACTCGAGTTATGTAGACGGTTGGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030562.2-1017s21c1
Sequence:CCGGCATCTCACTGACCGCTATTTCCTCGAGGAAATAGCGGTCAGTGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030562.2-422s21c1
Sequence:CCGGTCGTCGAGACTTCGCCAATATCTCGAGATATTGGCGAAGTCTCGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030562.2-601s21c1
Sequence:CCGGACTTGATCCTCGGCAACAATCCTCGAGGATTGTTGCCGAGGATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030562.2-763s21c1
Sequence:CCGGACAACCTCATTGATCACATTGCTCGAGCAATGTGATCAATGAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030562.1-709s1c1
Sequence:CCGGCACAACCTCATTGATCACATTCTCGAGAATGTGATCAATGAGGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030562.1-1489s1c1
Sequence:CCGGCAAGTGCAATACAACAGCTCTCTCGAGAGAGCTGTTGTATTGCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030562
LRFN1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and fibronectin type III domain containing 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030562.2-830s21c1
Sequence:CCGGGACCTCCAACCGTCTACATAACTCGAGTTATGTAGACGGTTGGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030562.2-1017s21c1
Sequence:CCGGCATCTCACTGACCGCTATTTCCTCGAGGAAATAGCGGTCAGTGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030562.2-422s21c1
Sequence:CCGGTCGTCGAGACTTCGCCAATATCTCGAGATATTGGCGAAGTCTCGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030562.2-601s21c1
Sequence:CCGGACTTGATCCTCGGCAACAATCCTCGAGGATTGTTGCCGAGGATCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030562.2-763s21c1
Sequence:CCGGACAACCTCATTGATCACATTGCTCGAGCAATGTGATCAATGAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030562.1-709s1c1
Sequence:CCGGCACAACCTCATTGATCACATTCTCGAGAATGTGATCAATGAGGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030562.1-1489s1c1
Sequence:CCGGCAAGTGCAATACAACAGCTCTCTCGAGAGAGCTGTTGTATTGCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)