EMAIL THIS PAGE TO A FRIEND

LRFN3

leucine rich repeat and fibronectin type III domain containing 3

50 Gene Product Result for
Synonyms: FIGLER1 SALM4
UniProtKB ID: Q9BTN0, Q6UY10
Gene ID:
Mouse(233067) leucine rich repeat and fibronectin type III domain containing 3
Rat(308495) leucine rich repeat and fibronectin type III domain containing 3
domestic guinea pig(100726644) leucine rich repeat and fibronectin type III domain containing 3
naked mole-rat(101708364) leucine rich repeat and fibronectin type III domain containing 3
sheep(101104680) leucine rich repeat and fibronectin type III domain containing 3
chicken(425605) leucine rich repeat and fibronectin type III domain containing 3
domestic cat(101086864) leucine rich repeat and fibronectin type III domain containing 3
cow(767839) leucine rich repeat and fibronectin type III domain containing 3
dog(100688169) leucine rich repeat and fibronectin type III domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024509 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024509 Rosetta Predictions human pricing
NM_001107502 Rosetta Predictions rat pricing
NM_175478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083740 predicted 896
2 SASI_Hs01_00083741 predicted 849
3 SASI_Hs01_00083742 predicted 1790
4 SASI_Hs02_00356778 predicted 1843
5 SASI_Hs01_00083743 predicted 1837
6 SASI_Hs01_00083744 predicted 1795
7 SASI_Hs01_00083745 predicted 1918
8 SASI_Hs01_00083746 predicted 1545
9 SASI_Hs01_00083747 predicted 898
10 SASI_Hs01_00083748 predicted 1879
11 SASI_Hs01_00083749 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229455 predicted 492
2 SASI_Rn02_00229456 predicted 271
3 SASI_Rn02_00229457 predicted 270
4 SASI_Rn02_00229458 predicted 1092
5 SASI_Rn02_00229459 predicted 1690
6 SASI_Rn02_00229460 predicted 1088
7 SASI_Rn02_00229461 predicted 344
8 SASI_Rn02_00229462 predicted 1607
9 SASI_Rn02_00229463 predicted 1514
10 SASI_Rn02_00229464 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153548 predicted 1332
2 SASI_Mm02_00346391 predicted 1253
3 SASI_Mm01_00153549 predicted 1108
4 SASI_Mm01_00153550 predicted 2416
5 SASI_Mm01_00153551 predicted 1403
6 SASI_Mm01_00153552 predicted 1505
7 SASI_Mm01_00153553 predicted 2092
8 SASI_Mm01_00153554 predicted 1225
9 SASI_Mm01_00153556 predicted 1691
10 SASI_Mm01_00153557 predicted 2305
11 SASI_Mm01_00153555 predicted 1235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175478
LRFN3 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and fibronectin type III domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175478.1-1337s1c1
Sequence:CCGGCCTCGATCTCTCTTATAATAACTCGAGTTATTATAAGAGAGATCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175478.1-2337s1c1
Sequence:CCGGCTATGTGTGCTCGCAGTCTATCTCGAGATAGACTGCGAGCACACATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175478.1-2525s1c1
Sequence:CCGGCGTGCTGCTTCTACGTTACAACTCGAGTTGTAACGTAGAAGCAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175478.1-1333s1c1
Sequence:CCGGAGGACCTCGATCTCTCTTATACTCGAGTATAAGAGAGATCGAGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175478.1-1003s1c1
Sequence:CCGGGCCTTCTATTCGTACCGCCATCTCGAGATGGCGGTACGAATAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175478
LRFN3 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and fibronectin type III domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175478.1-1337s1c1
Sequence:CCGGCCTCGATCTCTCTTATAATAACTCGAGTTATTATAAGAGAGATCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175478.1-2337s1c1
Sequence:CCGGCTATGTGTGCTCGCAGTCTATCTCGAGATAGACTGCGAGCACACATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175478.1-2525s1c1
Sequence:CCGGCGTGCTGCTTCTACGTTACAACTCGAGTTGTAACGTAGAAGCAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175478.1-1333s1c1
Sequence:CCGGAGGACCTCGATCTCTCTTATACTCGAGTATAAGAGAGATCGAGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175478.1-1003s1c1
Sequence:CCGGGCCTTCTATTCGTACCGCCATCTCGAGATGGCGGTACGAATAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175478
LRFN3 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and fibronectin type III domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175478.1-1337s1c1
Sequence:CCGGCCTCGATCTCTCTTATAATAACTCGAGTTATTATAAGAGAGATCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175478.1-2337s1c1
Sequence:CCGGCTATGTGTGCTCGCAGTCTATCTCGAGATAGACTGCGAGCACACATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175478.1-2525s1c1
Sequence:CCGGCGTGCTGCTTCTACGTTACAACTCGAGTTGTAACGTAGAAGCAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175478.1-1333s1c1
Sequence:CCGGAGGACCTCGATCTCTCTTATACTCGAGTATAAGAGAGATCGAGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175478.1-1003s1c1
Sequence:CCGGGCCTTCTATTCGTACCGCCATCTCGAGATGGCGGTACGAATAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024509
LRFN3 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and fibronectin type III domain containing 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024509.1-906s21c1
Sequence:CCGGGATGATTGTGCCGAGACACTGCTCGAGCAGTGTCTCGGCACAATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024509.1-1089s21c1
Sequence:CCGGTCCAACCGCCTGACCACAATCCTCGAGGATTGTGGTCAGGCGGTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024509.1-2095s21c1
Sequence:CCGGTAGCCTCGGTACTGGTCTTCACTCGAGTGAAGACCAGTACCGAGGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024509.1-2119s21c1
Sequence:CCGGTCGTGCTGCTAATGCGCTACACTCGAGTGTAGCGCATTAGCAGCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024509
LRFN3 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and fibronectin type III domain containing 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024509.1-906s21c1
Sequence:CCGGGATGATTGTGCCGAGACACTGCTCGAGCAGTGTCTCGGCACAATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024509.1-1089s21c1
Sequence:CCGGTCCAACCGCCTGACCACAATCCTCGAGGATTGTGGTCAGGCGGTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024509.1-2095s21c1
Sequence:CCGGTAGCCTCGGTACTGGTCTTCACTCGAGTGAAGACCAGTACCGAGGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024509.1-2119s21c1
Sequence:CCGGTCGTGCTGCTAATGCGCTACACTCGAGTGTAGCGCATTAGCAGCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024509
LRFN3 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and fibronectin type III domain containing 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024509.1-906s21c1
Sequence:CCGGGATGATTGTGCCGAGACACTGCTCGAGCAGTGTCTCGGCACAATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024509.1-1089s21c1
Sequence:CCGGTCCAACCGCCTGACCACAATCCTCGAGGATTGTGGTCAGGCGGTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024509.1-2095s21c1
Sequence:CCGGTAGCCTCGGTACTGGTCTTCACTCGAGTGAAGACCAGTACCGAGGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024509.1-2119s21c1
Sequence:CCGGTCGTGCTGCTAATGCGCTACACTCGAGTGTAGCGCATTAGCAGCACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)