EMAIL THIS PAGE TO A FRIEND

LRFN5

leucine rich repeat and fibronectin type III domain containing 5

61 Gene Product Result for
Synonyms: C14orf146 FIGLER8 SALM5
UniProtKB ID: Q96NI6, B3KU78, Q86XL2
Gene ID:
Mouse(238205) leucine rich repeat and fibronectin type III domain containing 5
Rat(314164) leucine rich repeat and fibronectin type III domain containing 5
domestic guinea pig(100713663) leucine rich repeat and fibronectin type III domain containing 5
chicken(423599) leucine rich repeat and fibronectin type III domain containing 5
cow(539366) leucine rich repeat and fibronectin type III domain containing 5
Horse(100051175) leucine rich repeat and fibronectin type III domain containing 5
domestic cat(101085550) leucine rich repeat and fibronectin type III domain containing 5
dog(490666) leucine rich repeat and fibronectin type III domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA001177 Anti-LRFN5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB3500020 Anti-LRFN5 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB2103210 Anti-LRFN5 antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, rat, bovine, zebrafish, mouse, human, canine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178714 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178714 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178714 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152447 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152447 Rosetta Predictions human pricing
NM_001108024 Rosetta Predictions rat pricing
NM_178714 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095705 predicted 2267
2 SASI_Hs02_00366212 predicted 2157
3 SASI_Hs01_00095706 predicted 1898
4 SASI_Hs01_00095707 predicted 1015
5 SASI_Hs01_00095708 predicted 1128
6 SASI_Hs01_00095709 predicted 704
7 SASI_Hs01_00095710 predicted 2725
8 SASI_Hs01_00095711 predicted 1277
9 SASI_Hs01_00095712 predicted 1610
10 SASI_Hs02_00366213 predicted 2057
11 SASI_Hs01_00095704 predicted 1830
12 SASI_Hs01_00095713 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108024 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234615 predicted 872
2 SASI_Rn02_00234616 predicted 1704
3 SASI_Rn02_00234617 predicted 2130
4 SASI_Rn02_00234618 predicted 2586
5 SASI_Rn02_00234619 predicted 2014
6 SASI_Rn02_00234620 predicted 1809
7 SASI_Rn02_00234621 predicted 1218
8 SASI_Rn02_00234622 predicted 1025
9 SASI_Rn02_00234623 predicted 1473
10 SASI_Rn02_00234624 predicted 1910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092747 predicted 786
2 SASI_Mm02_00349222 predicted 761
3 SASI_Mm01_00092748 predicted 1724
4 SASI_Mm01_00092750 predicted 2089
5 SASI_Mm01_00092751 predicted 2689
6 SASI_Mm01_00092752 predicted 2038
7 SASI_Mm01_00092753 predicted 2478
8 SASI_Mm01_00092754 predicted 1490
9 SASI_Mm01_00092755 predicted 936
10 SASI_Mm01_00092756 predicted 918
11 SASI_Mm01_00092749 predicted 513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178714
LRFN5 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and fibronectin type III domain containing 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178714.2-1721s1c1
Sequence:CCGGCGGAATCCGTATGTTTCAAATCTCGAGATTTGAAACATACGGATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178714.2-947s1c1
Sequence:CCGGCAACATTCCTAAGGGTACTTTCTCGAGAAAGTACCCTTAGGAATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178714.2-770s1c1
Sequence:CCGGCCACCATTTGATATTGAACAACTCGAGTTGTTCAATATCAAATGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178714.4-2032s21c1
Sequence:CCGGCATACTAATGATCCGGTATAACTCGAGTTATACCGGATCATTAGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216009    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178714.4-3218s1c1
Sequence:CCGGCAATTGAAGGCACGATATTATCTCGAGATAATATCGTGCCTTCAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178714.4-2983s21c1
Sequence:CCGGAGCGATTTCTCAGCCTATAAACTCGAGTTTATAGGCTGAGAAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178714.4-1607s21c1
Sequence:CCGGTCGAATGCTAGCAGTAGTAATCTCGAGATTACTACTGCTAGCATTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178714.4-1675s21c1
Sequence:CCGGTTCGTCAACAGCATTACTAAACTCGAGTTTAGTAATGCTGTTGACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178714.4-2084s21c1
Sequence:CCGGACGAAGGTTAGCAACGTTTATCTCGAGATAAACGTTGCTAACCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178714
LRFN5 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and fibronectin type III domain containing 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178714.2-1721s1c1
Sequence:CCGGCGGAATCCGTATGTTTCAAATCTCGAGATTTGAAACATACGGATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178714.2-947s1c1
Sequence:CCGGCAACATTCCTAAGGGTACTTTCTCGAGAAAGTACCCTTAGGAATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178714.2-770s1c1
Sequence:CCGGCCACCATTTGATATTGAACAACTCGAGTTGTTCAATATCAAATGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178714.4-2032s21c1
Sequence:CCGGCATACTAATGATCCGGTATAACTCGAGTTATACCGGATCATTAGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216009    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178714.4-3218s1c1
Sequence:CCGGCAATTGAAGGCACGATATTATCTCGAGATAATATCGTGCCTTCAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178714.4-2983s21c1
Sequence:CCGGAGCGATTTCTCAGCCTATAAACTCGAGTTTATAGGCTGAGAAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178714.4-1607s21c1
Sequence:CCGGTCGAATGCTAGCAGTAGTAATCTCGAGATTACTACTGCTAGCATTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178714.4-1675s21c1
Sequence:CCGGTTCGTCAACAGCATTACTAAACTCGAGTTTAGTAATGCTGTTGACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178714.4-2084s21c1
Sequence:CCGGACGAAGGTTAGCAACGTTTATCTCGAGATAAACGTTGCTAACCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178714
LRFN5 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and fibronectin type III domain containing 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178714.2-1721s1c1
Sequence:CCGGCGGAATCCGTATGTTTCAAATCTCGAGATTTGAAACATACGGATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178714.2-947s1c1
Sequence:CCGGCAACATTCCTAAGGGTACTTTCTCGAGAAAGTACCCTTAGGAATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178714.2-770s1c1
Sequence:CCGGCCACCATTTGATATTGAACAACTCGAGTTGTTCAATATCAAATGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178714.4-2032s21c1
Sequence:CCGGCATACTAATGATCCGGTATAACTCGAGTTATACCGGATCATTAGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216009    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178714.4-3218s1c1
Sequence:CCGGCAATTGAAGGCACGATATTATCTCGAGATAATATCGTGCCTTCAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178714.4-2983s21c1
Sequence:CCGGAGCGATTTCTCAGCCTATAAACTCGAGTTTATAGGCTGAGAAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178714.4-1607s21c1
Sequence:CCGGTCGAATGCTAGCAGTAGTAATCTCGAGATTACTACTGCTAGCATTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178714.4-1675s21c1
Sequence:CCGGTTCGTCAACAGCATTACTAAACTCGAGTTTAGTAATGCTGTTGACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178714.4-2084s21c1
Sequence:CCGGACGAAGGTTAGCAACGTTTATCTCGAGATAAACGTTGCTAACCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152447
LRFN5 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat and fibronectin type III domain containing 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152447.2-2898s1c1
Sequence:CCGGGAAATTGTCTACAGGAGCCAACTCGAGTTGGCTCCTGTAGACAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152447.2-2729s1c1
Sequence:CCGGGCTGACTAATGTTGACCAGATCTCGAGATCTGGTCAACATTAGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152447.2-1640s1c1
Sequence:CCGGCGGAACACTTGACATTCTTATCTCGAGATAAGAATGTCAAGTGTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152447.2-2793s1c1
Sequence:CCGGCTTCTCCTCTCTCTCCTGAAACTCGAGTTTCAGGAGAGAGAGGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152447.2-2914s1c1
Sequence:CCGGGCCAAGGTGAAAGTCTCTGATCTCGAGATCAGAGACTTTCACCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152447.3-1481s21c1
Sequence:CCGGTTCGCTGACCTACGAAATTTGCTCGAGCAAATTTCGTAGGTCAGCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152447.3-2850s21c1
Sequence:CCGGGGTATAAGGTTTGCAACAATACTCGAGTATTGTTGCAAACCTTATACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152447.3-2721s21c1
Sequence:CCGGTTACTACGGAACAGGATTATGCTCGAGCATAATCCTGTTCCGTAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152447
LRFN5 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat and fibronectin type III domain containing 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152447.2-2898s1c1
Sequence:CCGGGAAATTGTCTACAGGAGCCAACTCGAGTTGGCTCCTGTAGACAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152447.2-2729s1c1
Sequence:CCGGGCTGACTAATGTTGACCAGATCTCGAGATCTGGTCAACATTAGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152447.2-1640s1c1
Sequence:CCGGCGGAACACTTGACATTCTTATCTCGAGATAAGAATGTCAAGTGTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152447.2-2793s1c1
Sequence:CCGGCTTCTCCTCTCTCTCCTGAAACTCGAGTTTCAGGAGAGAGAGGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152447.2-2914s1c1
Sequence:CCGGGCCAAGGTGAAAGTCTCTGATCTCGAGATCAGAGACTTTCACCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152447.3-1481s21c1
Sequence:CCGGTTCGCTGACCTACGAAATTTGCTCGAGCAAATTTCGTAGGTCAGCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152447.3-2850s21c1
Sequence:CCGGGGTATAAGGTTTGCAACAATACTCGAGTATTGTTGCAAACCTTATACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152447.3-2721s21c1
Sequence:CCGGTTACTACGGAACAGGATTATGCTCGAGCATAATCCTGTTCCGTAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152447
LRFN5 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat and fibronectin type III domain containing 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152447.2-2898s1c1
Sequence:CCGGGAAATTGTCTACAGGAGCCAACTCGAGTTGGCTCCTGTAGACAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152447.2-2729s1c1
Sequence:CCGGGCTGACTAATGTTGACCAGATCTCGAGATCTGGTCAACATTAGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152447.2-1640s1c1
Sequence:CCGGCGGAACACTTGACATTCTTATCTCGAGATAAGAATGTCAAGTGTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152447.2-2793s1c1
Sequence:CCGGCTTCTCCTCTCTCTCCTGAAACTCGAGTTTCAGGAGAGAGAGGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152447.2-2914s1c1
Sequence:CCGGGCCAAGGTGAAAGTCTCTGATCTCGAGATCAGAGACTTTCACCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152447.3-1481s21c1
Sequence:CCGGTTCGCTGACCTACGAAATTTGCTCGAGCAAATTTCGTAGGTCAGCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152447.3-2850s21c1
Sequence:CCGGGGTATAAGGTTTGCAACAATACTCGAGTATTGTTGCAAACCTTATACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152447.3-2721s21c1
Sequence:CCGGTTACTACGGAACAGGATTATGCTCGAGCATAATCCTGTTCCGTAGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)