EMAIL THIS PAGE TO A FRIEND

LRG1

leucine-rich alpha-2-glycoprotein 1

54 Gene Product Result for
Synonyms: HMFT1766 LRG
UniProtKB ID: P02750, Q8N4F5, Q96QZ4
Gene ID:
Human(116844) Summary: The leucine-rich repeat (LRR) family of proteins, including LRG1, have been shown to be involved in protein-protein interaction, signal transduction, and cell adhesion and development. LRG1 is expressed during granulocyte differentiation (O'Donnell et al., 2002 [PubMed 12223515]
Mouse(76905) leucine-rich alpha-2-glycoprotein 1
Rat(367455) leucine-rich alpha-2-glycoprotein 1
chicken(426943) leucine-rich alpha-2-glycoprotein 1
dog(611876) leucine-rich alpha-2-glycoprotein 1
domestic cat(101082129) leucine-rich alpha-2-glycoprotein 1
cow(514663) leucine-rich alpha-2-glycoprotein 1
sheep(101111542) leucine-rich alpha-2-glycoprotein 1
domestic guinea pig(100735311) leucine-rich alpha-2-glycoprotein 1
naked mole-rat(101726001) leucine-rich alpha-2-glycoprotein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0529 AQUA Peptide ALGHLDLSGN[R] human pricing
AQ0530 AQUA Peptide (CM-Cys)AGPEAV[K] human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052972 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052972 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052972 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029796 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029796 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029796 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050181 MISSION® esiRNA esiRNA human LRG1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052972 Rosetta Predictions human pricing
NM_001009717 Rosetta Predictions rat pricing
NM_029796 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139084 predicted 654
2 SASI_Hs01_00139085 predicted 521
3 SASI_Hs01_00139086 predicted 665
4 SASI_Hs01_00139087 predicted 634
5 SASI_Hs02_00361786 predicted 274
6 SASI_Hs01_00139088 predicted 794
7 SASI_Hs02_00361787 predicted 281
8 SASI_Hs01_00139090 predicted 315
9 SASI_Hs01_00139091 predicted 433
10 SASI_Hs01_00139092 predicted 676
11 SASI_Hs01_00139089 predicted 662
12 SASI_Hs01_00139093 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009717 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111211 predicted 818
2 SASI_Rn01_00111212 predicted 901
3 SASI_Rn01_00111213 predicted 730
4 SASI_Rn01_00111214 predicted 990
5 SASI_Rn01_00111215 predicted 318
6 SASI_Rn01_00111216 predicted 463
7 SASI_Rn01_00111217 predicted 736
8 SASI_Rn01_00111218 predicted 542
9 SASI_Rn01_00111219 predicted 1054
10 SASI_Rn02_00199783 predicted 594
11 SASI_Rn01_00111220 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060250 predicted 810
2 SASI_Mm01_00060251 predicted 953
3 SASI_Mm01_00060252 predicted 985
4 SASI_Mm01_00060253 predicted 822
5 SASI_Mm01_00060254 predicted 535
6 SASI_Mm01_00060256 predicted 911
7 SASI_Mm01_00060257 predicted 830
8 SASI_Mm01_00060258 predicted 473
9 SASI_Mm02_00335939 predicted 745
10 SASI_Mm02_00335940 predicted 754
11 SASI_Mm01_00060255 predicted 827
12 SASI_Mm01_00060259 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052972
LRG1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich alpha-2-glycoprotein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052972.2-436s21c1
Sequence:CCGGTGGACACCCTGGTATTGAAAGCTCGAGCTTTCAATACCAGGGTGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052972.2-177s21c1
Sequence:CCGGTGTCAACCACCTGCCGAAATCCTCGAGGATTTCGGCAGGTGGTTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052972.2-361s21c1
Sequence:CCGGAGCTGAGGGTGCTGGATCTAACTCGAGTTAGATCCAGCACCCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052972.2-800s21c1
Sequence:CCGGCATGCTGGACCTCTCCAATAACTCGAGTTATTGGAGAGGTCCAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052972.1-62s1c1
Sequence:CCGGCCATGTTTCTAGAACTCTGTTCTCGAGAACAGAGTTCTAGAAACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052972.1-669s1c1
Sequence:CCGGGAAGGCAACAAATTGCAAGTACTCGAGTACTTGCAATTTGTTGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052972.2-1099s1c1
Sequence:CCGGGCAACCCGCTTAACAAATAATCTCGAGATTATTTGTTAAGCGGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052972.1-666s1c1
Sequence:CCGGCTAGAAGGCAACAAATTGCAACTCGAGTTGCAATTTGTTGCCTTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052972.1-297s1c1
Sequence:CCGGGAATTGCACCTCTCCAGCAATCTCGAGATTGCTGGAGAGGTGCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052972.1-645s1c1
Sequence:CCGGCTGCAATTAGAACGGCTACATCTCGAGATGTAGCCGTTCTAATTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052972.1-61s1c1
Sequence:CCGGCCCATGTTTCTAGAACTCTGTCTCGAGACAGAGTTCTAGAAACATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052972
LRG1 MISSION shRNA shRNA Plasmid DNA
leucine-rich alpha-2-glycoprotein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052972.2-436s21c1
Sequence:CCGGTGGACACCCTGGTATTGAAAGCTCGAGCTTTCAATACCAGGGTGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052972.2-177s21c1
Sequence:CCGGTGTCAACCACCTGCCGAAATCCTCGAGGATTTCGGCAGGTGGTTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052972.2-361s21c1
Sequence:CCGGAGCTGAGGGTGCTGGATCTAACTCGAGTTAGATCCAGCACCCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052972.2-800s21c1
Sequence:CCGGCATGCTGGACCTCTCCAATAACTCGAGTTATTGGAGAGGTCCAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052972.1-62s1c1
Sequence:CCGGCCATGTTTCTAGAACTCTGTTCTCGAGAACAGAGTTCTAGAAACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052972.1-669s1c1
Sequence:CCGGGAAGGCAACAAATTGCAAGTACTCGAGTACTTGCAATTTGTTGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052972.2-1099s1c1
Sequence:CCGGGCAACCCGCTTAACAAATAATCTCGAGATTATTTGTTAAGCGGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052972.1-666s1c1
Sequence:CCGGCTAGAAGGCAACAAATTGCAACTCGAGTTGCAATTTGTTGCCTTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052972.1-297s1c1
Sequence:CCGGGAATTGCACCTCTCCAGCAATCTCGAGATTGCTGGAGAGGTGCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052972.1-645s1c1
Sequence:CCGGCTGCAATTAGAACGGCTACATCTCGAGATGTAGCCGTTCTAATTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052972.1-61s1c1
Sequence:CCGGCCCATGTTTCTAGAACTCTGTCTCGAGACAGAGTTCTAGAAACATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052972
LRG1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich alpha-2-glycoprotein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052972.2-436s21c1
Sequence:CCGGTGGACACCCTGGTATTGAAAGCTCGAGCTTTCAATACCAGGGTGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052972.2-177s21c1
Sequence:CCGGTGTCAACCACCTGCCGAAATCCTCGAGGATTTCGGCAGGTGGTTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052972.2-361s21c1
Sequence:CCGGAGCTGAGGGTGCTGGATCTAACTCGAGTTAGATCCAGCACCCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052972.2-800s21c1
Sequence:CCGGCATGCTGGACCTCTCCAATAACTCGAGTTATTGGAGAGGTCCAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052972.1-62s1c1
Sequence:CCGGCCATGTTTCTAGAACTCTGTTCTCGAGAACAGAGTTCTAGAAACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052972.1-669s1c1
Sequence:CCGGGAAGGCAACAAATTGCAAGTACTCGAGTACTTGCAATTTGTTGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052972.2-1099s1c1
Sequence:CCGGGCAACCCGCTTAACAAATAATCTCGAGATTATTTGTTAAGCGGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052972.1-666s1c1
Sequence:CCGGCTAGAAGGCAACAAATTGCAACTCGAGTTGCAATTTGTTGCCTTCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052972.1-297s1c1
Sequence:CCGGGAATTGCACCTCTCCAGCAATCTCGAGATTGCTGGAGAGGTGCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052972.1-645s1c1
Sequence:CCGGCTGCAATTAGAACGGCTACATCTCGAGATGTAGCCGTTCTAATTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052972.1-61s1c1
Sequence:CCGGCCCATGTTTCTAGAACTCTGTCTCGAGACAGAGTTCTAGAAACATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029796
LRG1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich alpha-2-glycoprotein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000111200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029796.2-1152s1c1
Sequence:CCGGGTCAGTGTGCAGATTCCTCATCTCGAGATGAGGAATCTGCACACTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029796.2-156s1c1
Sequence:CCGGCCTCAAGGAATGCCTGATACTCTCGAGAGTATCAGGCATTCCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029796.2-249s1c1
Sequence:CCGGTGTCCATCTGTCGGTGGAATTCTCGAGAATTCCACCGACAGATGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029796.2-984s1c1
Sequence:CCGGCGCCAACCGAAACAAGATGTTCTCGAGAACATCTTGTTTCGGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029796
LRG1 MISSION shRNA shRNA Plasmid DNA
leucine-rich alpha-2-glycoprotein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000111200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029796.2-1152s1c1
Sequence:CCGGGTCAGTGTGCAGATTCCTCATCTCGAGATGAGGAATCTGCACACTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029796.2-156s1c1
Sequence:CCGGCCTCAAGGAATGCCTGATACTCTCGAGAGTATCAGGCATTCCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029796.2-249s1c1
Sequence:CCGGTGTCCATCTGTCGGTGGAATTCTCGAGAATTCCACCGACAGATGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029796.2-984s1c1
Sequence:CCGGCGCCAACCGAAACAAGATGTTCTCGAGAACATCTTGTTTCGGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029796
LRG1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich alpha-2-glycoprotein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000111200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029796.2-1152s1c1
Sequence:CCGGGTCAGTGTGCAGATTCCTCATCTCGAGATGAGGAATCTGCACACTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029796.2-156s1c1
Sequence:CCGGCCTCAAGGAATGCCTGATACTCTCGAGAGTATCAGGCATTCCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029796.2-249s1c1
Sequence:CCGGTGTCCATCTGTCGGTGGAATTCTCGAGAATTCCACCGACAGATGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029796.2-984s1c1
Sequence:CCGGCGCCAACCGAAACAAGATGTTCTCGAGAACATCTTGTTTCGGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)