EMAIL THIS PAGE TO A FRIEND

LRGUK

leucine-rich repeats and guanylate kinase domain containing

83 Gene Product Result for
UniProtKB ID: Q96M69, Q2M3I1
Gene ID:
Mouse(74354) leucine-rich repeats and guanylate kinase domain containing
Rat(296968) leucine-rich repeats and guanylate kinase domain containing
naked mole-rat(101720831) leucine-rich repeats and guanylate kinase domain containing
Domestic Rabbit(100341260) leucine-rich repeats and guanylate kinase domain containing
domestic guinea pig(100726745) leucine-rich repeats and guanylate kinase domain containing
sheep(101120321) leucine-rich repeats and guanylate kinase domain containing
Zebrafish(559670) leucine-rich repeats and guanylate kinase domain containing
chicken(416699) leucine-rich repeats and guanylate kinase domain containing
cow(529920) leucine-rich repeats and guanylate kinase domain containing
Horse(100068231) leucine-rich repeats and guanylate kinase domain containing
domestic cat(101094916) leucine-rich repeats and guanylate kinase domain containing
dog(475184) leucine-rich repeats and guanylate kinase domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144648 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144648 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144648 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_133060 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_133060 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_133060 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_028886 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028886 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028886 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144648 Rosetta Predictions human pricing
NM_001106589 Rosetta Predictions rat pricing
XM_231594 Rosetta Predictions rat pricing
XM_133060 Rosetta Predictions mouse pricing
XM_910825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190028 predicted 1891
2 SASI_Hs01_00190029 predicted 719
3 SASI_Hs02_00364514 predicted 1314
4 SASI_Hs02_00364515 predicted 1453
5 SASI_Hs01_00190031 predicted 491
6 SASI_Hs01_00190033 predicted 2056
7 SASI_Hs01_00190035 predicted 1251
8 SASI_Hs02_00364516 predicted 1467
9 SASI_Hs01_00190036 predicted 468
10 SASI_Hs01_00190037 predicted 2300
11 SASI_Hs01_00190030 predicted 1268
12 SASI_Hs01_00190032 predicted 1040
13 SASI_Hs01_00190034 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106589 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220438 predicted 528
2 SASI_Rn02_00220439 predicted 1653
3 SASI_Rn02_00220440 predicted 2396
4 SASI_Rn02_00220441 predicted 1643
5 SASI_Rn02_00220442 predicted 1540
6 SASI_Rn02_00220443 predicted 1541
7 SASI_Rn02_00220444 predicted 925
8 SASI_Rn02_00220445 predicted 733
9 SASI_Rn02_00220446 predicted 495
10 SASI_Rn02_00220447 predicted 1561
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171153 predicted 2703
2 SASI_Rn01_00171154 predicted 3659
3 SASI_Rn01_00171155 predicted 1641
4 SASI_Rn01_00171156 predicted 2253
5 SASI_Rn01_00171157 predicted 2249
6 SASI_Rn01_00171158 predicted 2139
7 SASI_Rn01_00171159 predicted 2145
8 SASI_Rn01_00171160 predicted 3802
9 SASI_Rn01_00171161 predicted 1064
10 SASI_Rn01_00171162 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424506 predicted 294
2 SASI_Mm01_00283448 predicted 2205
3 SASI_Mm02_00424507 predicted 456
4 SASI_Mm02_00424508 predicted 383
5 SASI_Mm02_00424509 predicted 1855
6 SASI_Mm02_00424510 predicted 2502
7 SASI_Mm01_00283452 predicted 1937
8 SASI_Mm01_00283453 predicted 2134
9 SASI_Mm01_00283455 predicted 2327
10 SASI_Mm02_00424511 predicted 2218
11 SASI_Mm01_00283449 predicted 1559
12 SASI_Mm01_00283450 predicted 653
13 SASI_Mm01_00283451 predicted 1542
14 SASI_Mm01_00283454 predicted 494
15 SASI_Mm01_00283456 predicted 1852
16 SASI_Mm01_00283457 predicted 1866
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435943 predicted 2206
2 SASI_Mm02_00435944 predicted 643
3 SASI_Mm02_00435945 predicted 1543
4 SASI_Mm02_00435946 predicted 1941
5 SASI_Mm02_00435947 predicted 2136
6 SASI_Mm02_00435948 predicted 486
7 SASI_Mm02_00435949 predicted 530
8 SASI_Mm02_00435950 predicted 2327
9 SASI_Mm02_00435951 predicted 1841
10 SASI_Mm02_00435952 predicted 1854
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144648
LRGUK MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and guanylate kinase domain containing
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144648.1-1186s1c1
Sequence:CCGGCCATGTTGTCAACAGCGTGATCTCGAGATCACGCTGTTGACAACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144648.1-102s1c1
Sequence:CCGGCGTTACAGTTTCGCGCAGAAACTCGAGTTTCTGCGCGAAACTGTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144648.1-1833s1c1
Sequence:CCGGCTGCCAAGAGTTTGGCTACAACTCGAGTTGTAGCCAAACTCTTGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144648.1-1994s1c1
Sequence:CCGGCCAGCGGAAAGAGATTCTATACTCGAGTATAGAATCTCTTTCCGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144648.1-1889s1c1
Sequence:CCGGGCGCATCCTACAAAGTATATTCTCGAGAATATACTTTGTAGGATGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144648.1-653s1c1
Sequence:CCGGGCGTATCATGCTCTCACTAAACTCGAGTTTAGTGAGAGCATGATACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144648.1-2499s1c1
Sequence:CCGGGCACTTGATGTCTGATCCTAACTCGAGTTAGGATCAGACATCAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144648.1-750s1c1
Sequence:CCGGCCAACAATAAGATCACGACAACTCGAGTTGTCGTGATCTTATTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144648.1-1390s21c1
Sequence:CCGGGGATCGAGTTGATTATCATTTCTCGAGAAATGATAATCAACTCGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144648.1-476s21c1
Sequence:CCGGTTGGATCTTTCAGCGAATAAACTCGAGTTTATTCGCTGAAAGATCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144648.1-754s21c1
Sequence:CCGGCAATAAGATCACGACAATTAACTCGAGTTAATTGTCGTGATCTTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144648
LRGUK MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and guanylate kinase domain containing
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144648.1-1186s1c1
Sequence:CCGGCCATGTTGTCAACAGCGTGATCTCGAGATCACGCTGTTGACAACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144648.1-102s1c1
Sequence:CCGGCGTTACAGTTTCGCGCAGAAACTCGAGTTTCTGCGCGAAACTGTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144648.1-1833s1c1
Sequence:CCGGCTGCCAAGAGTTTGGCTACAACTCGAGTTGTAGCCAAACTCTTGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144648.1-1994s1c1
Sequence:CCGGCCAGCGGAAAGAGATTCTATACTCGAGTATAGAATCTCTTTCCGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144648.1-1889s1c1
Sequence:CCGGGCGCATCCTACAAAGTATATTCTCGAGAATATACTTTGTAGGATGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144648.1-653s1c1
Sequence:CCGGGCGTATCATGCTCTCACTAAACTCGAGTTTAGTGAGAGCATGATACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144648.1-2499s1c1
Sequence:CCGGGCACTTGATGTCTGATCCTAACTCGAGTTAGGATCAGACATCAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144648.1-750s1c1
Sequence:CCGGCCAACAATAAGATCACGACAACTCGAGTTGTCGTGATCTTATTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144648.1-1390s21c1
Sequence:CCGGGGATCGAGTTGATTATCATTTCTCGAGAAATGATAATCAACTCGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144648.1-476s21c1
Sequence:CCGGTTGGATCTTTCAGCGAATAAACTCGAGTTTATTCGCTGAAAGATCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144648.1-754s21c1
Sequence:CCGGCAATAAGATCACGACAATTAACTCGAGTTAATTGTCGTGATCTTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144648
LRGUK MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and guanylate kinase domain containing
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144648.1-1186s1c1
Sequence:CCGGCCATGTTGTCAACAGCGTGATCTCGAGATCACGCTGTTGACAACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144648.1-102s1c1
Sequence:CCGGCGTTACAGTTTCGCGCAGAAACTCGAGTTTCTGCGCGAAACTGTAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144648.1-1833s1c1
Sequence:CCGGCTGCCAAGAGTTTGGCTACAACTCGAGTTGTAGCCAAACTCTTGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144648.1-1994s1c1
Sequence:CCGGCCAGCGGAAAGAGATTCTATACTCGAGTATAGAATCTCTTTCCGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144648.1-1889s1c1
Sequence:CCGGGCGCATCCTACAAAGTATATTCTCGAGAATATACTTTGTAGGATGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144648.1-653s1c1
Sequence:CCGGGCGTATCATGCTCTCACTAAACTCGAGTTTAGTGAGAGCATGATACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144648.1-2499s1c1
Sequence:CCGGGCACTTGATGTCTGATCCTAACTCGAGTTAGGATCAGACATCAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144648.1-750s1c1
Sequence:CCGGCCAACAATAAGATCACGACAACTCGAGTTGTCGTGATCTTATTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144648.1-1390s21c1
Sequence:CCGGGGATCGAGTTGATTATCATTTCTCGAGAAATGATAATCAACTCGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144648.1-476s21c1
Sequence:CCGGTTGGATCTTTCAGCGAATAAACTCGAGTTTATTCGCTGAAAGATCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144648.1-754s21c1
Sequence:CCGGCAATAAGATCACGACAATTAACTCGAGTTAATTGTCGTGATCTTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_133060
LRGUK MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and guanylate kinase domain containing
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000025506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133060.2-1941s1c1
Sequence:CCGGCCAAATTATGGGCCAAACTTTCTCGAGAAAGTTTGGCCCATAATTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133060.2-553s1c1
Sequence:CCGGGCTGACTACCTTCTTCAATTTCTCGAGAAATTGAAGAAGGTAGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133060.2-931s1c1
Sequence:CCGGCCTGGAGGATAACAAGATTAACTCGAGTTAATCTTGTTATCCTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133060.2-2172s1c1
Sequence:CCGGCCTCTGGAACATACCCTGAAACTCGAGTTTCAGGGTATGTTCCAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_133060
LRGUK MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and guanylate kinase domain containing
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000025506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133060.2-1941s1c1
Sequence:CCGGCCAAATTATGGGCCAAACTTTCTCGAGAAAGTTTGGCCCATAATTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133060.2-553s1c1
Sequence:CCGGGCTGACTACCTTCTTCAATTTCTCGAGAAATTGAAGAAGGTAGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133060.2-931s1c1
Sequence:CCGGCCTGGAGGATAACAAGATTAACTCGAGTTAATCTTGTTATCCTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133060.2-2172s1c1
Sequence:CCGGCCTCTGGAACATACCCTGAAACTCGAGTTTCAGGGTATGTTCCAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_133060
LRGUK MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and guanylate kinase domain containing
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000025506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133060.2-1941s1c1
Sequence:CCGGCCAAATTATGGGCCAAACTTTCTCGAGAAAGTTTGGCCCATAATTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133060.2-553s1c1
Sequence:CCGGGCTGACTACCTTCTTCAATTTCTCGAGAAATTGAAGAAGGTAGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133060.2-931s1c1
Sequence:CCGGCCTGGAGGATAACAAGATTAACTCGAGTTAATCTTGTTATCCTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133060.2-2172s1c1
Sequence:CCGGCCTCTGGAACATACCCTGAAACTCGAGTTTCAGGGTATGTTCCAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028886
LRGUK MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and guanylate kinase domain containing
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028886.1-653s21c1
Sequence:CCGGATACTCTCACTCAACTAATTTCTCGAGAAATTAGTTGAGTGAGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028886.1-1042s21c1
Sequence:CCGGTACTGGTTCTTCGTGATATATCTCGAGATATATCACGAAGAACCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028886.1-1383s21c1
Sequence:CCGGAGATCGAGTTGATTATCATTTCTCGAGAAATGATAATCAACTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028886.1-1660s21c1
Sequence:CCGGAGTCGCGCAGAAATCGAAATTCTCGAGAATTTCGATTTCTGCGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028886
LRGUK MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and guanylate kinase domain containing
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028886.1-653s21c1
Sequence:CCGGATACTCTCACTCAACTAATTTCTCGAGAAATTAGTTGAGTGAGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028886.1-1042s21c1
Sequence:CCGGTACTGGTTCTTCGTGATATATCTCGAGATATATCACGAAGAACCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028886.1-1383s21c1
Sequence:CCGGAGATCGAGTTGATTATCATTTCTCGAGAAATGATAATCAACTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028886.1-1660s21c1
Sequence:CCGGAGTCGCGCAGAAATCGAAATTCTCGAGAATTTCGATTTCTGCGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028886
LRGUK MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and guanylate kinase domain containing
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028886.1-653s21c1
Sequence:CCGGATACTCTCACTCAACTAATTTCTCGAGAAATTAGTTGAGTGAGAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028886.1-1042s21c1
Sequence:CCGGTACTGGTTCTTCGTGATATATCTCGAGATATATCACGAAGAACCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028886.1-1383s21c1
Sequence:CCGGAGATCGAGTTGATTATCATTTCTCGAGAAATGATAATCAACTCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028886.1-1660s21c1
Sequence:CCGGAGTCGCGCAGAAATCGAAATTCTCGAGAATTTCGATTTCTGCGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)