EMAIL THIS PAGE TO A FRIEND

LRIF1

ligand dependent nuclear receptor interacting factor 1

118 Gene Product Result for
Synonyms: C1orf103 RIF1 RP11-96K19.1
UniProtKB ID: Q5T3J3, Q86XS4, Q8N3B6, Q96HT4, Q9NUM5, Q9NV32
Gene ID:
Mouse(321000) ligand dependent nuclear receptor interacting factor 1
Rat(310775) ligand dependent nuclear receptor interacting factor 1
chicken(421150) ligand dependent nuclear receptor interacting factor 1
dog(479906) ligand dependent nuclear receptor interacting factor 1
cow(539067) ligand dependent nuclear receptor interacting factor 1
domestic cat(101084641) ligand dependent nuclear receptor interacting factor 1
sheep(101105972) ligand dependent nuclear receptor interacting factor 1
domestic guinea pig(100722678) ligand dependent nuclear receptor interacting factor 1
naked mole-rat(101719979) ligand dependent nuclear receptor interacting factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018372 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177309 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177309 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177309 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145641 MISSION® esiRNA esiRNA human C1orf103 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006945 Rosetta Predictions human pricing
NM_018372 Rosetta Predictions human pricing
NM_001127485 Rosetta Predictions rat pricing
NM_001039478 Rosetta Predictions mouse pricing
NM_001039488 Rosetta Predictions mouse pricing
NM_028081 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079020 predicted 925
2 SASI_Hs01_00079021 predicted 1012
3 SASI_Hs01_00079024 predicted 924
4 SASI_Hs01_00079025 predicted 999
5 SASI_Hs01_00079026 predicted 920
6 SASI_Hs01_00079027 predicted 931
7 SASI_Hs01_00079028 predicted 929
8 SASI_Hs01_00079029 predicted 920
9 SASI_Hs02_00305158 predicted 1007
10 SASI_Hs02_00305159 predicted 918
11 SASI_Hs01_00079022 predicted 970
12 SASI_Hs01_00079023 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018885 predicted 2337
2 SASI_Hs01_00018886 predicted 2088
3 SASI_Hs01_00018887 predicted 2453
4 SASI_Hs01_00018888 predicted 2361
5 SASI_Hs01_00018889 predicted 2381
6 SASI_Hs01_00018890 predicted 2371
7 SASI_Hs01_00018891 predicted 2265
8 SASI_Hs01_00018892 predicted 2262
9 SASI_Hs01_00018893 predicted 2243
10 SASI_Hs01_00018894 predicted 2527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127485 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253853 predicted 905
2 SASI_Rn02_00253854 predicted 1338
3 SASI_Rn02_00253855 predicted 1182
4 SASI_Rn02_00253856 predicted 960
5 SASI_Rn02_00253857 predicted 332
6 SASI_Rn02_00253858 predicted 1111
7 SASI_Rn02_00253859 predicted 473
8 SASI_Rn02_00253860 predicted 2257
9 SASI_Rn02_00253861 predicted 899
10 SASI_Rn02_00253862 predicted 1486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099968 predicted 1051
2 SASI_Mm01_00099969 predicted 839
3 SASI_Mm01_00099970 predicted 1248
4 SASI_Mm01_00099971 predicted 887
5 SASI_Mm01_00099972 predicted 1233
6 SASI_Mm02_00290069 predicted 1211
7 SASI_Mm01_00099973 predicted 876
8 SASI_Mm01_00099974 predicted 950
9 SASI_Mm01_00099975 predicted 1097
10 SASI_Mm01_00099977 predicted 1356
11 SASI_Mm01_00099976 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023799 predicted 2812
2 SASI_Mm01_00023800 predicted 2595
3 SASI_Mm01_00023801 predicted 3002
4 SASI_Mm01_00023802 predicted 2645
5 SASI_Mm01_00023803 predicted 2994
6 SASI_Mm02_00290075 predicted 2969
7 SASI_Mm01_00023804 predicted 2634
8 SASI_Mm01_00023805 predicted 2709
9 SASI_Mm01_00023806 predicted 2856
10 SASI_Mm01_00023808 predicted 3112
11 SASI_Mm01_00023807 predicted 2741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333315 predicted 1331
2 SASI_Mm01_00135877 predicted 1233
3 SASI_Mm01_00135878 predicted 1107
4 SASI_Mm01_00135879 predicted 1123
5 SASI_Mm01_00135880 predicted 1527
6 SASI_Mm01_00135881 predicted 1164
7 SASI_Mm01_00135882 predicted 1511
8 SASI_Mm01_00135883 predicted 1272
9 SASI_Mm02_00333316 predicted 1490
10 SASI_Mm02_00333317 predicted 950
11 SASI_Mm01_00135876 predicted 1316
12 SASI_Mm01_00135884 predicted 1160
13 SASI_Mm01_00135885 predicted 1383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018372
VALIDATED
LRIF1 MISSION shRNA Bacterial Glycerol Stock
ligand dependent nuclear receptor interacting factor 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018372.3-1671s21c1
Sequence:CCGGTATTCACAAATCCAATCTTTCCTCGAGGAAAGATTGGATTTGTGAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018372.2-543s1c1
Sequence:CCGGGCCAGCCAGTTCTTCAAACTACTCGAGTAGTTTGAAGAACTGGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018372.2-2380s1c1
Sequence:CCGGGCAGCTTATGAACAAAGTCATCTCGAGATGACTTTGTTCATAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_018372.2-2234s1c1
Sequence:CCGGCCCAACTCCTAAGCAGTATTTCTCGAGAAATACTGCTTAGGAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018372.2-2021s1c1
Sequence:CCGGCCTCTGGAGAAGGTTTCGATTCTCGAGAATCGAAACCTTCTCCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018372.2-1125s1c1
Sequence:CCGGCCAAGATAATCTACAGCCTTTCTCGAGAAAGGCTGTAGATTATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018372.3-2882s21c1
Sequence:CCGGCTAAATTGCTCAGGCATTATTCTCGAGAATAATGCCTGAGCAATTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018372.3-927s21c1
Sequence:CCGGCCCAAATGCCAACCGTTATTTCTCGAGAAATAACGGTTGGCATTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018372.3-2199s21c1
Sequence:CCGGATGCTTATAACGCAATCATAACTCGAGTTATGATTGCGTTATAAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018372.3-2272s21c1
Sequence:CCGGTTCAGATGTGTCACAACATAACTCGAGTTATGTTGTGACACATCTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018372.3-1558s21c1
Sequence:CCGGTGCTTCCATGGCCAATCTAAGCTCGAGCTTAGATTGGCCATGGAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018372
VALIDATED
LRIF1 MISSION shRNA shRNA Plasmid DNA
ligand dependent nuclear receptor interacting factor 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018372.3-1671s21c1
Sequence:CCGGTATTCACAAATCCAATCTTTCCTCGAGGAAAGATTGGATTTGTGAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018372.2-543s1c1
Sequence:CCGGGCCAGCCAGTTCTTCAAACTACTCGAGTAGTTTGAAGAACTGGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018372.2-2380s1c1
Sequence:CCGGGCAGCTTATGAACAAAGTCATCTCGAGATGACTTTGTTCATAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_018372.2-2234s1c1
Sequence:CCGGCCCAACTCCTAAGCAGTATTTCTCGAGAAATACTGCTTAGGAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018372.2-2021s1c1
Sequence:CCGGCCTCTGGAGAAGGTTTCGATTCTCGAGAATCGAAACCTTCTCCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018372.2-1125s1c1
Sequence:CCGGCCAAGATAATCTACAGCCTTTCTCGAGAAAGGCTGTAGATTATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018372.3-2882s21c1
Sequence:CCGGCTAAATTGCTCAGGCATTATTCTCGAGAATAATGCCTGAGCAATTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018372.3-927s21c1
Sequence:CCGGCCCAAATGCCAACCGTTATTTCTCGAGAAATAACGGTTGGCATTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018372.3-2199s21c1
Sequence:CCGGATGCTTATAACGCAATCATAACTCGAGTTATGATTGCGTTATAAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018372.3-2272s21c1
Sequence:CCGGTTCAGATGTGTCACAACATAACTCGAGTTATGTTGTGACACATCTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018372.3-1558s21c1
Sequence:CCGGTGCTTCCATGGCCAATCTAAGCTCGAGCTTAGATTGGCCATGGAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018372
VALIDATED
LRIF1 MISSION shRNA Lentiviral Transduction Particles
ligand dependent nuclear receptor interacting factor 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018372.3-1671s21c1
Sequence:CCGGTATTCACAAATCCAATCTTTCCTCGAGGAAAGATTGGATTTGTGAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018372.2-543s1c1
Sequence:CCGGGCCAGCCAGTTCTTCAAACTACTCGAGTAGTTTGAAGAACTGGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018372.2-2380s1c1
Sequence:CCGGGCAGCTTATGAACAAAGTCATCTCGAGATGACTTTGTTCATAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_018372.2-2234s1c1
Sequence:CCGGCCCAACTCCTAAGCAGTATTTCTCGAGAAATACTGCTTAGGAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018372.2-2021s1c1
Sequence:CCGGCCTCTGGAGAAGGTTTCGATTCTCGAGAATCGAAACCTTCTCCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018372.2-1125s1c1
Sequence:CCGGCCAAGATAATCTACAGCCTTTCTCGAGAAAGGCTGTAGATTATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018372.3-2882s21c1
Sequence:CCGGCTAAATTGCTCAGGCATTATTCTCGAGAATAATGCCTGAGCAATTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018372.3-927s21c1
Sequence:CCGGCCCAAATGCCAACCGTTATTTCTCGAGAAATAACGGTTGGCATTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018372.3-2199s21c1
Sequence:CCGGATGCTTATAACGCAATCATAACTCGAGTTATGATTGCGTTATAAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018372.3-2272s21c1
Sequence:CCGGTTCAGATGTGTCACAACATAACTCGAGTTATGTTGTGACACATCTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018372.3-1558s21c1
Sequence:CCGGTGCTTCCATGGCCAATCTAAGCTCGAGCTTAGATTGGCCATGGAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177309
LRIF1 MISSION shRNA Bacterial Glycerol Stock
ligand dependent nuclear receptor interacting factor 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-438s1c1
Sequence:CCGGGCATGTACCAAGTAGTTCCTACTCGAGTAGGAACTACTTGGTACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-1543s1c1
Sequence:CCGGCACAGAAATATCCAGAGAGATCTCGAGATCTCTCTGGATATTTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-1373s1c1
Sequence:CCGGCACTCCGTAAGTGAACCTATTCTCGAGAATAGGTTCACTTACGGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-442s1c1
Sequence:CCGGGTACCAAGTAGTTCCTACGATCTCGAGATCGTAGGAACTACTTGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-1240s1c1
Sequence:CCGGCCCATGTATTATTCCTGTTAACTCGAGTTAACAGGAATAATACATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-621s1c1
Sequence:CCGGCCACAAGTGCATCTGTTCAATCTCGAGATTGAACAGATGCACTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177309
LRIF1 MISSION shRNA shRNA Plasmid DNA
ligand dependent nuclear receptor interacting factor 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-438s1c1
Sequence:CCGGGCATGTACCAAGTAGTTCCTACTCGAGTAGGAACTACTTGGTACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-1543s1c1
Sequence:CCGGCACAGAAATATCCAGAGAGATCTCGAGATCTCTCTGGATATTTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-1373s1c1
Sequence:CCGGCACTCCGTAAGTGAACCTATTCTCGAGAATAGGTTCACTTACGGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-442s1c1
Sequence:CCGGGTACCAAGTAGTTCCTACGATCTCGAGATCGTAGGAACTACTTGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-1240s1c1
Sequence:CCGGCCCATGTATTATTCCTGTTAACTCGAGTTAACAGGAATAATACATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-621s1c1
Sequence:CCGGCCACAAGTGCATCTGTTCAATCTCGAGATTGAACAGATGCACTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177309
LRIF1 MISSION shRNA Lentiviral Transduction Particles
ligand dependent nuclear receptor interacting factor 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-438s1c1
Sequence:CCGGGCATGTACCAAGTAGTTCCTACTCGAGTAGGAACTACTTGGTACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-1543s1c1
Sequence:CCGGCACAGAAATATCCAGAGAGATCTCGAGATCTCTCTGGATATTTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-1373s1c1
Sequence:CCGGCACTCCGTAAGTGAACCTATTCTCGAGAATAGGTTCACTTACGGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-442s1c1
Sequence:CCGGGTACCAAGTAGTTCCTACGATCTCGAGATCGTAGGAACTACTTGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-1240s1c1
Sequence:CCGGCCCATGTATTATTCCTGTTAACTCGAGTTAACAGGAATAATACATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177309.2-621s1c1
Sequence:CCGGCCACAAGTGCATCTGTTCAATCTCGAGATTGAACAGATGCACTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)