EMAIL THIS PAGE TO A FRIEND

LRIG1

leucine-rich repeats and immunoglobulin-like domains 1

107 Gene Product Result for
Synonyms: LIG-1 LIG1
UniProtKB ID: Q96JA1, Q6IQ51, Q96CF9, Q9BYB8, Q9UFI4
Gene ID:
Mouse(16206) leucine-rich repeats and immunoglobulin-like domains 1
Rat(312574) leucine-rich repeats and immunoglobulin-like domains 1
naked mole-rat(101712761) leucine-rich repeats and immunoglobulin-like domains 1
Domestic Rabbit(100339149) leucine-rich repeats and immunoglobulin-like domains 1
domestic guinea pig(100730479) leucine-rich repeats and immunoglobulin-like domains 1
sheep(101106117) leucine-rich repeats and immunoglobulin-like domains 1
Zebrafish(560325) leucine-rich repeats and immunoglobulin-like domains 1
cow(505750) leucine-rich repeats and immunoglobulin-like domains 1
Horse(100064196) leucine-rich repeats and immunoglobulin-like domains 1
chicken(427592) leucine-rich repeats and immunoglobulin-like domains 1
dog(484698) leucine-rich repeats and immunoglobulin-like domains 1
domestic cat(101087908) leucine-rich repeats and immunoglobulin-like domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA011846 Anti-LRIG1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4200445 Monoclonal Anti-LRIG1 antibody produced in mouse ~1.0 mg/mL, clone LRIG1-21, purified immunoglobulin human
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008377 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008377 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008377 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015541 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015541 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015541 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015541 Rosetta Predictions human pricing
XM_001076882 Rosetta Predictions rat pricing
XM_232237 Rosetta Predictions rat pricing
NM_008377 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050974 predicted 1755
2 SASI_Hs01_00050975 predicted 3377
3 SASI_Hs02_00348066 predicted 441
4 SASI_Hs01_00050976 predicted 1303
5 SASI_Hs02_00348067 predicted 1427
6 SASI_Hs02_00348068 predicted 884
7 SASI_Hs01_00050979 predicted 3166
8 SASI_Hs01_00050980 predicted 453
9 SASI_Hs01_00050981 predicted 2795
10 SASI_Hs01_00050982 predicted 1101
11 SASI_Hs01_00050977 predicted 2287
12 SASI_Hs01_00050978 predicted 1796
13 SASI_Hs01_00050983 predicted 1428
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354894 predicted 1260
2 SASI_Rn02_00354895 predicted 2483
3 SASI_Rn02_00354896 predicted 3102
4 SASI_Rn02_00354897 predicted 463
5 SASI_Rn02_00354898 predicted 451
6 SASI_Rn02_00354899 predicted 232
7 SASI_Rn02_00354900 predicted 1096
8 SASI_Rn02_00354901 predicted 2511
9 SASI_Rn02_00354902 predicted 2031
10 SASI_Rn02_00354903 predicted 1927
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387031 predicted 924
2 SASI_Rn02_00387032 predicted 2773
3 SASI_Rn02_00387033 predicted 204
4 SASI_Rn02_00387034 predicted 840
5 SASI_Rn02_00387035 predicted 301
6 SASI_Rn02_00387036 predicted 2727
7 SASI_Rn02_00387037 predicted 736
8 SASI_Rn02_00387038 predicted 746
9 SASI_Rn02_00387039 predicted 2664
10 SASI_Rn02_00387040 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107556 predicted 916
2 SASI_Mm02_00313741 predicted 1479
3 SASI_Mm01_00107557 predicted 2117
4 SASI_Mm02_00313742 predicted 1706
5 SASI_Mm01_00107559 predicted 904
6 SASI_Mm01_00107560 predicted 2743
7 SASI_Mm01_00107562 predicted 2963
8 SASI_Mm01_00107563 predicted 684
9 SASI_Mm01_00107564 predicted 732
10 SASI_Mm01_00107565 predicted 1103
11 SASI_Mm01_00107558 predicted 2215
12 SASI_Mm01_00107561 predicted 1574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008377
VALIDATED
LRIG1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and immunoglobulin-like domains 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008377.2-2730s21c1
Sequence:CCGGTAGACGATGCAGGGCGGTATACTCGAGTATACCGCCCTGCATCGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008377.2-1125s21c1
Sequence:CCGGGGAATCGGATTCGGCTGATTGCTCGAGCAATCAGCCGAATCCGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008377.2-3886s21c1
Sequence:CCGGAGAAACGTGAGAGACTATTTGCTCGAGCAAATAGTCTCTCACGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008377.2-909s21c1
Sequence:CCGGCCAACAACATCACGGAAATTCCTCGAGGAATTTCCGTGATGTTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008377.1-671s1c1
Sequence:CCGGGCAGCCTAAACCTGAGTTATACTCGAGTATAACTCAGGTTTAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008377.1-2936s1c1
Sequence:CCGGGCGTCACTAACACAGATGAAACTCGAGTTTCATCTGTGTTAGTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008377.2-2943s21c1
Sequence:CCGGGCGTCACTAACACAGATGAAACTCGAGTTTCATCTGTGTTAGTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008377.1-4620s1c1
Sequence:CCGGCCATAGTTGATGGTTAATGTTCTCGAGAACATTAACCATCAACTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008377.1-1483s1c1
Sequence:CCGGGCCATCAGTCACATTGCTGAACTCGAGTTCAGCAATGTGACTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008377.1-1096s1c1
Sequence:CCGGCTGACACAACTAGACCTGAATCTCGAGATTCAGGTCTAGTTGTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008377
VALIDATED
LRIG1 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and immunoglobulin-like domains 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008377.2-2730s21c1
Sequence:CCGGTAGACGATGCAGGGCGGTATACTCGAGTATACCGCCCTGCATCGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008377.2-1125s21c1
Sequence:CCGGGGAATCGGATTCGGCTGATTGCTCGAGCAATCAGCCGAATCCGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008377.2-3886s21c1
Sequence:CCGGAGAAACGTGAGAGACTATTTGCTCGAGCAAATAGTCTCTCACGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008377.2-909s21c1
Sequence:CCGGCCAACAACATCACGGAAATTCCTCGAGGAATTTCCGTGATGTTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008377.1-671s1c1
Sequence:CCGGGCAGCCTAAACCTGAGTTATACTCGAGTATAACTCAGGTTTAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008377.1-2936s1c1
Sequence:CCGGGCGTCACTAACACAGATGAAACTCGAGTTTCATCTGTGTTAGTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008377.2-2943s21c1
Sequence:CCGGGCGTCACTAACACAGATGAAACTCGAGTTTCATCTGTGTTAGTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008377.1-4620s1c1
Sequence:CCGGCCATAGTTGATGGTTAATGTTCTCGAGAACATTAACCATCAACTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008377.1-1483s1c1
Sequence:CCGGGCCATCAGTCACATTGCTGAACTCGAGTTCAGCAATGTGACTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008377.1-1096s1c1
Sequence:CCGGCTGACACAACTAGACCTGAATCTCGAGATTCAGGTCTAGTTGTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008377
VALIDATED
LRIG1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and immunoglobulin-like domains 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008377.2-2730s21c1
Sequence:CCGGTAGACGATGCAGGGCGGTATACTCGAGTATACCGCCCTGCATCGTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008377.2-1125s21c1
Sequence:CCGGGGAATCGGATTCGGCTGATTGCTCGAGCAATCAGCCGAATCCGATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008377.2-3886s21c1
Sequence:CCGGAGAAACGTGAGAGACTATTTGCTCGAGCAAATAGTCTCTCACGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008377.2-909s21c1
Sequence:CCGGCCAACAACATCACGGAAATTCCTCGAGGAATTTCCGTGATGTTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008377.1-671s1c1
Sequence:CCGGGCAGCCTAAACCTGAGTTATACTCGAGTATAACTCAGGTTTAGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008377.1-2936s1c1
Sequence:CCGGGCGTCACTAACACAGATGAAACTCGAGTTTCATCTGTGTTAGTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008377.2-2943s21c1
Sequence:CCGGGCGTCACTAACACAGATGAAACTCGAGTTTCATCTGTGTTAGTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008377.1-4620s1c1
Sequence:CCGGCCATAGTTGATGGTTAATGTTCTCGAGAACATTAACCATCAACTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008377.1-1483s1c1
Sequence:CCGGGCCATCAGTCACATTGCTGAACTCGAGTTCAGCAATGTGACTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008377.1-1096s1c1
Sequence:CCGGCTGACACAACTAGACCTGAATCTCGAGATTCAGGTCTAGTTGTGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015541
VALIDATED
LRIG1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and immunoglobulin-like domains 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015541.2-2046s21c1
Sequence:CCGGGCCGGTTCTATTTCAGCTAATCTCGAGATTAGCTGAAATAGAACCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015541.1-2045s1c2
Sequence:CCGGGCAAGGACATCCGGTTTACATCTCGAGATGTAAACCGGATGTCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015541.1-1125s1c1
Sequence:CCGGGCTTCCTGTAAGAGCATTCAACTCGAGTTGAATGCTCTTACAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015541.1-3062s1c1
Sequence:CCGGCCCTTTCTGACCGACAAGAAACTCGAGTTTCTTGTCGGTCAGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015541.2-1096s21c1
Sequence:CCGGATCTGGACCATAACGAGATTTCTCGAGAAATCTCGTTATGGTCCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015541.2-2557s21c1
Sequence:CCGGCCCTTTCTGACCGACAAGAAACTCGAGTTTCTTGTCGGTCAGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015541.2-3671s21c1
Sequence:CCGGTAACGCATGGCTGGAATTTATCTCGAGATAAATTCCAGCCATGCGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015541.2-491s21c1
Sequence:CCGGTCCACACGGACCGCCTATAAACTCGAGTTTATAGGCGGTCCGTGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015541.1-729s1c2
Sequence:CCGGGCGGAGCCTAAACCTGAGTTACTCGAGTAACTCAGGTTTAGGCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015541
VALIDATED
LRIG1 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and immunoglobulin-like domains 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015541.2-2046s21c1
Sequence:CCGGGCCGGTTCTATTTCAGCTAATCTCGAGATTAGCTGAAATAGAACCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015541.1-2045s1c2
Sequence:CCGGGCAAGGACATCCGGTTTACATCTCGAGATGTAAACCGGATGTCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015541.1-1125s1c1
Sequence:CCGGGCTTCCTGTAAGAGCATTCAACTCGAGTTGAATGCTCTTACAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015541.1-3062s1c1
Sequence:CCGGCCCTTTCTGACCGACAAGAAACTCGAGTTTCTTGTCGGTCAGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015541.2-1096s21c1
Sequence:CCGGATCTGGACCATAACGAGATTTCTCGAGAAATCTCGTTATGGTCCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015541.2-2557s21c1
Sequence:CCGGCCCTTTCTGACCGACAAGAAACTCGAGTTTCTTGTCGGTCAGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015541.2-3671s21c1
Sequence:CCGGTAACGCATGGCTGGAATTTATCTCGAGATAAATTCCAGCCATGCGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015541.2-491s21c1
Sequence:CCGGTCCACACGGACCGCCTATAAACTCGAGTTTATAGGCGGTCCGTGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015541.1-729s1c2
Sequence:CCGGGCGGAGCCTAAACCTGAGTTACTCGAGTAACTCAGGTTTAGGCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015541
VALIDATED
LRIG1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and immunoglobulin-like domains 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015541.2-2046s21c1
Sequence:CCGGGCCGGTTCTATTTCAGCTAATCTCGAGATTAGCTGAAATAGAACCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015541.1-2045s1c2
Sequence:CCGGGCAAGGACATCCGGTTTACATCTCGAGATGTAAACCGGATGTCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015541.1-1125s1c1
Sequence:CCGGGCTTCCTGTAAGAGCATTCAACTCGAGTTGAATGCTCTTACAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015541.1-3062s1c1
Sequence:CCGGCCCTTTCTGACCGACAAGAAACTCGAGTTTCTTGTCGGTCAGAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015541.2-1096s21c1
Sequence:CCGGATCTGGACCATAACGAGATTTCTCGAGAAATCTCGTTATGGTCCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015541.2-2557s21c1
Sequence:CCGGCCCTTTCTGACCGACAAGAAACTCGAGTTTCTTGTCGGTCAGAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015541.2-3671s21c1
Sequence:CCGGTAACGCATGGCTGGAATTTATCTCGAGATAAATTCCAGCCATGCGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015541.2-491s21c1
Sequence:CCGGTCCACACGGACCGCCTATAAACTCGAGTTTATAGGCGGTCCGTGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015541.1-729s1c2
Sequence:CCGGGCGGAGCCTAAACCTGAGTTACTCGAGTAACTCAGGTTTAGGCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)