EMAIL THIS PAGE TO A FRIEND

LRIG2

leucine-rich repeats and immunoglobulin-like domains 2

111 Gene Product Result for
Synonyms: LIG-2 LIG2 UFS2
UniProtKB ID: O94898, Q9NSN2
Gene ID:
Mouse(269473) leucine-rich repeats and immunoglobulin-like domains 2
Rat(310753) leucine-rich repeats and immunoglobulin-like domains 2
Zebrafish(571101) leucine-rich repeats and immunoglobulin-like domains 2
cow(535493) leucine-rich repeats and immunoglobulin-like domains 2
Horse(100064414) leucine-rich repeats and immunoglobulin-like domains 2
domestic cat(101099316) leucine-rich repeats and immunoglobulin-like domains 2
dog(483215) leucine-rich repeats and immunoglobulin-like domains 2
chicken(100857856) leucine-rich repeats and immunoglobulin-like domains 2
sheep(101108540) leucine-rich repeats and immunoglobulin-like domains 2
domestic guinea pig(100728195) leucine-rich repeats and immunoglobulin-like domains 2
Domestic Rabbit(100347832) leucine-rich repeats and immunoglobulin-like domains 2
naked mole-rat(101709399) leucine-rich repeats and immunoglobulin-like domains 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014813 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025067 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025067 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025067 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014813 Rosetta Predictions human pricing
NM_001107710 Rosetta Predictions rat pricing
NM_001025067 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062366 predicted 522
2 SASI_Hs01_00062367 predicted 1217
3 SASI_Hs01_00062368 predicted 776
4 SASI_Hs01_00062369 predicted 1134
5 SASI_Hs02_00346342 predicted 1552
6 SASI_Hs01_00062371 predicted 1197
7 SASI_Hs02_00346343 predicted 2496
8 SASI_Hs01_00062374 predicted 2251
9 SASI_Hs02_00346344 predicted 3402
10 SASI_Hs01_00062375 predicted 2734
11 SASI_Hs01_00062370 predicted 1951
12 SASI_Hs01_00062372 predicted 2204
13 SASI_Hs01_00062373 predicted 2371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107710 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231505 predicted 1383
2 SASI_Rn02_00231506 predicted 1039
3 SASI_Rn02_00231507 predicted 3339
4 SASI_Rn02_00231508 predicted 517
5 SASI_Rn02_00231509 predicted 1947
6 SASI_Rn02_00231510 predicted 3299
7 SASI_Rn02_00231511 predicted 1973
8 SASI_Rn02_00231512 predicted 1811
9 SASI_Rn02_00231513 predicted 2500
10 SASI_Rn02_00231514 predicted 1573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118652 predicted 725
2 SASI_Mm01_00118653 predicted 1278
3 SASI_Mm01_00118654 predicted 1006
4 SASI_Mm01_00118656 predicted 2161
5 SASI_Mm02_00287764 predicted 1183
6 SASI_Mm01_00118657 predicted 2233
7 SASI_Mm01_00118658 predicted 2148
8 SASI_Mm01_00118659 predicted 3019
9 SASI_Mm01_00118660 predicted 3346
10 SASI_Mm01_00118661 predicted 1888
11 SASI_Mm01_00118655 predicted 1914
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014813
VALIDATED
LRIG2 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and immunoglobulin-like domains 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014813.1-3019s21c1
Sequence:CCGGATGCCTAAAGAGACATATTTACTCGAGTAAATATGTCTCTTTAGGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014813.1-1375s21c1
Sequence:CCGGTTACAAGGAAACCAGATTAAGCTCGAGCTTAATCTGGTTTCCTTGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014813.1-748s21c1
Sequence:CCGGGCTGGTTGCTTCGATAATTTACTCGAGTAAATTATCGAAGCAACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014813.1-3415s21c1
Sequence:CCGGATCTGGGCAGAGACTTATTAACTCGAGTTAATAAGTCTCTGCCCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014813.1-3469s21c1
Sequence:CCGGGAAACTCCGAAGTCAGCATTTCTCGAGAAATGCTGACTTCGGAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014813.1-1243s21c1
Sequence:CCGGCATATTGCTGATGGTGTATTTCTCGAGAAATACACCATCAGCAATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014813.1-3353s21c1
Sequence:CCGCTTAGTAGGACTCGGAACATTCCTCGAGGAATGTTCCGAGTCCTACTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014813.1-3832s1c1
Sequence:CCGGCCTGGGATTCTTCAGTGGTTTCTCGAGAAACCACTGAAGAATCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014813.1-2642s1c1
Sequence:CCGGGCTGTGTTGTTGGCACTTCTTCTCGAGAAGAAGTGCCAACAACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014813.1-3534s1c1
Sequence:CCGGGCCATGCGTTGTTTGGTCTTACTCGAGTAAGACCAAACAACGCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014813.1-444s1c1
Sequence:CCGGCAGTCATAATCGGTTGTCTAACTCGAGTTAGACAACCGATTATGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014813.1-1139s1c1
Sequence:CCGGCCGAACTTGATTTGTCCTATACTCGAGTATAGGACAAATCAAGTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014813.1-3536s1c1
Sequence:CCGGCATGCGTTGTTTGGTCTTATACTCGAGTATAAGACCAAACAACGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014813.1-3535s1c1
Sequence:CCGGCCATGCGTTGTTTGGTCTTATCTCGAGATAAGACCAAACAACGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014813.1-3113s1c1
Sequence:CCGGCCACCAACCATGAGAGGATAACTCGAGTTATCCTCTCATGGTTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014813
VALIDATED
LRIG2 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and immunoglobulin-like domains 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014813.1-3019s21c1
Sequence:CCGGATGCCTAAAGAGACATATTTACTCGAGTAAATATGTCTCTTTAGGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014813.1-1375s21c1
Sequence:CCGGTTACAAGGAAACCAGATTAAGCTCGAGCTTAATCTGGTTTCCTTGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014813.1-748s21c1
Sequence:CCGGGCTGGTTGCTTCGATAATTTACTCGAGTAAATTATCGAAGCAACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014813.1-3415s21c1
Sequence:CCGGATCTGGGCAGAGACTTATTAACTCGAGTTAATAAGTCTCTGCCCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014813.1-3469s21c1
Sequence:CCGGGAAACTCCGAAGTCAGCATTTCTCGAGAAATGCTGACTTCGGAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014813.1-1243s21c1
Sequence:CCGGCATATTGCTGATGGTGTATTTCTCGAGAAATACACCATCAGCAATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014813.1-3353s21c1
Sequence:CCGCTTAGTAGGACTCGGAACATTCCTCGAGGAATGTTCCGAGTCCTACTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014813.1-3832s1c1
Sequence:CCGGCCTGGGATTCTTCAGTGGTTTCTCGAGAAACCACTGAAGAATCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014813.1-2642s1c1
Sequence:CCGGGCTGTGTTGTTGGCACTTCTTCTCGAGAAGAAGTGCCAACAACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014813.1-3534s1c1
Sequence:CCGGGCCATGCGTTGTTTGGTCTTACTCGAGTAAGACCAAACAACGCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014813.1-444s1c1
Sequence:CCGGCAGTCATAATCGGTTGTCTAACTCGAGTTAGACAACCGATTATGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014813.1-1139s1c1
Sequence:CCGGCCGAACTTGATTTGTCCTATACTCGAGTATAGGACAAATCAAGTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014813.1-3536s1c1
Sequence:CCGGCATGCGTTGTTTGGTCTTATACTCGAGTATAAGACCAAACAACGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014813.1-3535s1c1
Sequence:CCGGCCATGCGTTGTTTGGTCTTATCTCGAGATAAGACCAAACAACGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014813.1-3113s1c1
Sequence:CCGGCCACCAACCATGAGAGGATAACTCGAGTTATCCTCTCATGGTTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014813
VALIDATED
LRIG2 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and immunoglobulin-like domains 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014813.1-3019s21c1
Sequence:CCGGATGCCTAAAGAGACATATTTACTCGAGTAAATATGTCTCTTTAGGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014813.1-1375s21c1
Sequence:CCGGTTACAAGGAAACCAGATTAAGCTCGAGCTTAATCTGGTTTCCTTGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014813.1-748s21c1
Sequence:CCGGGCTGGTTGCTTCGATAATTTACTCGAGTAAATTATCGAAGCAACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014813.1-3415s21c1
Sequence:CCGGATCTGGGCAGAGACTTATTAACTCGAGTTAATAAGTCTCTGCCCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014813.1-3469s21c1
Sequence:CCGGGAAACTCCGAAGTCAGCATTTCTCGAGAAATGCTGACTTCGGAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014813.1-1243s21c1
Sequence:CCGGCATATTGCTGATGGTGTATTTCTCGAGAAATACACCATCAGCAATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014813.1-3353s21c1
Sequence:CCGCTTAGTAGGACTCGGAACATTCCTCGAGGAATGTTCCGAGTCCTACTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014813.1-3832s1c1
Sequence:CCGGCCTGGGATTCTTCAGTGGTTTCTCGAGAAACCACTGAAGAATCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014813.1-2642s1c1
Sequence:CCGGGCTGTGTTGTTGGCACTTCTTCTCGAGAAGAAGTGCCAACAACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014813.1-3534s1c1
Sequence:CCGGGCCATGCGTTGTTTGGTCTTACTCGAGTAAGACCAAACAACGCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014813.1-444s1c1
Sequence:CCGGCAGTCATAATCGGTTGTCTAACTCGAGTTAGACAACCGATTATGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014813.1-1139s1c1
Sequence:CCGGCCGAACTTGATTTGTCCTATACTCGAGTATAGGACAAATCAAGTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014813.1-3536s1c1
Sequence:CCGGCATGCGTTGTTTGGTCTTATACTCGAGTATAAGACCAAACAACGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014813.1-3535s1c1
Sequence:CCGGCCATGCGTTGTTTGGTCTTATCTCGAGATAAGACCAAACAACGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014813.1-3113s1c1
Sequence:CCGGCCACCAACCATGAGAGGATAACTCGAGTTATCCTCTCATGGTTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025067
LRIG2 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and immunoglobulin-like domains 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025067.1-6135s1c1
Sequence:CCGGGCCCTGTATTTGTTCTCCTTACTCGAGTAAGGAGAACAAATACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025067.1-3260s1c1
Sequence:CCGGGCAGGTTACATGACCATGCTTCTCGAGAAGCATGGTCATGTAACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025067.1-417s1c1
Sequence:CCGGCCGGTTGTCTAACTGGAACAACTCGAGTTGTTCCAGTTAGACAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025067.1-1021s1c1
Sequence:CCGGCGAATGTTACAGCAACTGTATCTCGAGATACAGTTGCTGTAACATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025067.1-1135s1c1
Sequence:CCGGCGCCTTGATGAATCTGCCTTTCTCGAGAAAGGCAGATTCATCAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025067
LRIG2 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and immunoglobulin-like domains 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025067.1-6135s1c1
Sequence:CCGGGCCCTGTATTTGTTCTCCTTACTCGAGTAAGGAGAACAAATACAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025067.1-3260s1c1
Sequence:CCGGGCAGGTTACATGACCATGCTTCTCGAGAAGCATGGTCATGTAACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025067.1-417s1c1
Sequence:CCGGCCGGTTGTCTAACTGGAACAACTCGAGTTGTTCCAGTTAGACAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025067.1-1021s1c1
Sequence:CCGGCGAATGTTACAGCAACTGTATCTCGAGATACAGTTGCTGTAACATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025067.1-1135s1c1
Sequence:CCGGCGCCTTGATGAATCTGCCTTTCTCGAGAAAGGCAGATTCATCAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025067
LRIG2 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and immunoglobulin-like domains 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025067.1-6135s1c1
Sequence:CCGGGCCCTGTATTTGTTCTCCTTACTCGAGTAAGGAGAACAAATACAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025067.1-3260s1c1
Sequence:CCGGGCAGGTTACATGACCATGCTTCTCGAGAAGCATGGTCATGTAACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025067.1-417s1c1
Sequence:CCGGCCGGTTGTCTAACTGGAACAACTCGAGTTGTTCCAGTTAGACAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025067.1-1021s1c1
Sequence:CCGGCGAATGTTACAGCAACTGTATCTCGAGATACAGTTGCTGTAACATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025067.1-1135s1c1
Sequence:CCGGCGCCTTGATGAATCTGCCTTTCTCGAGAAAGGCAGATTCATCAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)