EMAIL THIS PAGE TO A FRIEND

LRIG3

leucine-rich repeats and immunoglobulin-like domains 3

100 Gene Product Result for
Synonyms: LIG3
UniProtKB ID: Q6UXM1, Q6UXL7, Q8NC72
Gene ID:
Mouse(320398) leucine-rich repeats and immunoglobulin-like domains 3
Rat(299830) leucine-rich repeats and immunoglobulin-like domains 3
naked mole-rat(101725483) leucine-rich repeats and immunoglobulin-like domains 3
Domestic Rabbit(100356331) leucine-rich repeats and immunoglobulin-like domains 3
domestic guinea pig(100715725) leucine-rich repeats and immunoglobulin-like domains 3
sheep(101118351) leucine-rich repeats and immunoglobulin-like domains 3
Zebrafish(564554) leucine-rich repeats and immunoglobulin-like domains 3
dog(474423) leucine-rich repeats and immunoglobulin-like domains 3
Horse(100054709) leucine-rich repeats and immunoglobulin-like domains 3
cow(506574) leucine-rich repeats and immunoglobulin-like domains 3
domestic cat(101083861) leucine-rich repeats and immunoglobulin-like domains 3
chicken(417813) leucine-rich repeats and immunoglobulin-like domains 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1565 Human LRIG3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153377 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153377 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153377 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177152 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177152 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177152 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153377 Rosetta Predictions human pricing
XM_001055013 Rosetta Predictions rat pricing
XM_216905 Rosetta Predictions rat pricing
NM_177152 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128311 predicted 1428
2 SASI_Hs01_00128312 predicted 1545
3 SASI_Hs01_00128313 predicted 2487
4 SASI_Hs01_00128316 predicted 3283
5 SASI_Hs02_00367270 predicted 2669
6 SASI_Hs01_00128318 predicted 3047
7 SASI_Hs01_00128319 predicted 2817
8 SASI_Hs01_00128320 predicted 1398
9 SASI_Hs02_00367271 predicted 3112
10 SASI_Hs02_00367272 predicted 1269
11 SASI_Hs01_00128314 predicted 1192
12 SASI_Hs01_00128315 predicted 3583
13 SASI_Hs01_00128317 predicted 2328
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278092 predicted 1593
2 SASI_Rn02_00278093 predicted 1251
3 SASI_Rn02_00278094 predicted 3296
4 SASI_Rn02_00278095 predicted 1869
5 SASI_Rn02_00278096 predicted 2023
6 SASI_Rn02_00278097 predicted 2673
7 SASI_Rn02_00278098 predicted 1598
8 SASI_Rn02_00278099 predicted 940
9 SASI_Rn02_00278100 predicted 3719
10 SASI_Rn02_00278101 predicted 3420
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216905 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376887 predicted 1590
2 SASI_Rn02_00376888 predicted 1246
3 SASI_Rn02_00376889 predicted 3293
4 SASI_Rn02_00376890 predicted 1869
5 SASI_Rn02_00376891 predicted 2020
6 SASI_Rn02_00376892 predicted 2673
7 SASI_Rn02_00376893 predicted 1605
8 SASI_Rn02_00376894 predicted 938
9 SASI_Rn02_00376895 predicted 3718
10 SASI_Rn02_00376896 predicted 3418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177152 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098888 predicted 1013
2 SASI_Mm01_00098889 predicted 1352
3 SASI_Mm01_00098890 predicted 690
4 SASI_Mm01_00098891 predicted 1779
5 SASI_Mm01_00098892 predicted 697
6 SASI_Mm01_00098893 predicted 1148
7 SASI_Mm01_00098894 predicted 2716
8 SASI_Mm01_00098895 predicted 1218
9 SASI_Mm02_00347151 predicted 1047
10 SASI_Mm01_00098897 predicted 1711
11 SASI_Mm01_00098896 predicted 2709
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153377
LRIG3 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and immunoglobulin-like domains 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153377.3-594s21c1
Sequence:CCGGGGGACCAGTCTCGGCAAATATCTCGAGATATTTGCCGAGACTGGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-2797s1c1
Sequence:CCGGCCAGCAGATATTCCTAGTTATCTCGAGATAACTAGGAATATCTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-3344s1c1
Sequence:CCGGCGAGTAATTCTTTCATGGGTACTCGAGTACCCATGAAAGAATTACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-1494s1c1
Sequence:CCGGCCTGAGTGACAACGCAATCATCTCGAGATGATTGCGTTGTCACTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-1759s1c1
Sequence:CCGGCCAGAAACACAGTCGGCAATACTCGAGTATTGCCGACTGTGTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-2851s1c1
Sequence:CCGGGATGGGTACGTGTCTTCAGAACTCGAGTTCTGAAGACACGTACCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153377.3-1196s21c1
Sequence:CCGGACCTAACTTTCAATCACTTATCTCGAGATAAGTGATTGAAAGTTAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-1414s1c1
Sequence:CCGGCGACTGATACTCCAAGGAAATCTCGAGATTTCCTTGGAGTATCAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153377.3-3774s1c1
Sequence:CCGGCTGGGAATGATGCTCATATAACTCGAGTTATATGAGCATCATTCCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153377.3-2799s21c1
Sequence:CCGGAGCAGATATTCCTAGTTATTTCTCGAGAAATAACTAGGAATATCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-2290s1c1
Sequence:CCGGGCAGGAAGTATTTCAGCAAATCTCGAGATTTGCTGAAATACTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153377
LRIG3 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and immunoglobulin-like domains 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153377.3-594s21c1
Sequence:CCGGGGGACCAGTCTCGGCAAATATCTCGAGATATTTGCCGAGACTGGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-2797s1c1
Sequence:CCGGCCAGCAGATATTCCTAGTTATCTCGAGATAACTAGGAATATCTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-3344s1c1
Sequence:CCGGCGAGTAATTCTTTCATGGGTACTCGAGTACCCATGAAAGAATTACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-1494s1c1
Sequence:CCGGCCTGAGTGACAACGCAATCATCTCGAGATGATTGCGTTGTCACTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-1759s1c1
Sequence:CCGGCCAGAAACACAGTCGGCAATACTCGAGTATTGCCGACTGTGTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-2851s1c1
Sequence:CCGGGATGGGTACGTGTCTTCAGAACTCGAGTTCTGAAGACACGTACCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153377.3-1196s21c1
Sequence:CCGGACCTAACTTTCAATCACTTATCTCGAGATAAGTGATTGAAAGTTAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-1414s1c1
Sequence:CCGGCGACTGATACTCCAAGGAAATCTCGAGATTTCCTTGGAGTATCAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153377.3-3774s1c1
Sequence:CCGGCTGGGAATGATGCTCATATAACTCGAGTTATATGAGCATCATTCCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153377.3-2799s21c1
Sequence:CCGGAGCAGATATTCCTAGTTATTTCTCGAGAAATAACTAGGAATATCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-2290s1c1
Sequence:CCGGGCAGGAAGTATTTCAGCAAATCTCGAGATTTGCTGAAATACTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153377
LRIG3 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and immunoglobulin-like domains 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153377.3-594s21c1
Sequence:CCGGGGGACCAGTCTCGGCAAATATCTCGAGATATTTGCCGAGACTGGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-2797s1c1
Sequence:CCGGCCAGCAGATATTCCTAGTTATCTCGAGATAACTAGGAATATCTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-3344s1c1
Sequence:CCGGCGAGTAATTCTTTCATGGGTACTCGAGTACCCATGAAAGAATTACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-1494s1c1
Sequence:CCGGCCTGAGTGACAACGCAATCATCTCGAGATGATTGCGTTGTCACTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-1759s1c1
Sequence:CCGGCCAGAAACACAGTCGGCAATACTCGAGTATTGCCGACTGTGTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-2851s1c1
Sequence:CCGGGATGGGTACGTGTCTTCAGAACTCGAGTTCTGAAGACACGTACCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153377.3-1196s21c1
Sequence:CCGGACCTAACTTTCAATCACTTATCTCGAGATAAGTGATTGAAAGTTAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-1414s1c1
Sequence:CCGGCGACTGATACTCCAAGGAAATCTCGAGATTTCCTTGGAGTATCAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153377.3-3774s1c1
Sequence:CCGGCTGGGAATGATGCTCATATAACTCGAGTTATATGAGCATCATTCCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153377.3-2799s21c1
Sequence:CCGGAGCAGATATTCCTAGTTATTTCTCGAGAAATAACTAGGAATATCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153377.3-2290s1c1
Sequence:CCGGGCAGGAAGTATTTCAGCAAATCTCGAGATTTGCTGAAATACTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177152
VALIDATED
LRIG3 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeats and immunoglobulin-like domains 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177152.4-3727s1c1
Sequence:CCGGCCGGGAATAACTTTCATATAACTCGAGTTATATGAAAGTTATTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177152.4-693s1c1
Sequence:CCGGCCACCCTTACAACTCAAGTATCTCGAGATACTTGAGTTGTAAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177152.4-3283s1c1
Sequence:CCGGCGGCTACTTCAAGTAACTCATCTCGAGATGAGTTACTTGAAGTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177152.4-863s1c1
Sequence:CCGGGCTGAACAGAAACAAGATTAACTCGAGTTAATCTTGTTTCTGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177152.4-3012s1c1
Sequence:CCGGCCAGATCCATTTGAAGTTTATCTCGAGATAAACTTCAAATGGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177152
VALIDATED
LRIG3 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeats and immunoglobulin-like domains 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177152.4-3727s1c1
Sequence:CCGGCCGGGAATAACTTTCATATAACTCGAGTTATATGAAAGTTATTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177152.4-693s1c1
Sequence:CCGGCCACCCTTACAACTCAAGTATCTCGAGATACTTGAGTTGTAAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177152.4-3283s1c1
Sequence:CCGGCGGCTACTTCAAGTAACTCATCTCGAGATGAGTTACTTGAAGTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177152.4-863s1c1
Sequence:CCGGGCTGAACAGAAACAAGATTAACTCGAGTTAATCTTGTTTCTGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177152.4-3012s1c1
Sequence:CCGGCCAGATCCATTTGAAGTTTATCTCGAGATAAACTTCAAATGGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177152
VALIDATED
LRIG3 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeats and immunoglobulin-like domains 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177152.4-3727s1c1
Sequence:CCGGCCGGGAATAACTTTCATATAACTCGAGTTATATGAAAGTTATTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177152.4-693s1c1
Sequence:CCGGCCACCCTTACAACTCAAGTATCTCGAGATACTTGAGTTGTAAGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177152.4-3283s1c1
Sequence:CCGGCGGCTACTTCAAGTAACTCATCTCGAGATGAGTTACTTGAAGTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177152.4-863s1c1
Sequence:CCGGGCTGAACAGAAACAAGATTAACTCGAGTTAATCTTGTTTCTGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177152.4-3012s1c1
Sequence:CCGGCCAGATCCATTTGAAGTTTATCTCGAGATAAACTTCAAATGGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)